CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Hemsleya Graciliflora

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGTCGATGCCTAAACATCAGAACGACCCGCGAACATGTTCAACAACCCGGGGCGTGGCGGTCCGAGAGGGCCGCCCCGTCCCTCCCCCGCACCGGTGGTCGGGGCCGCGCCTCCAGCGTGCGCCCCAGCCCCGTCACGGGTAACCAAACCCCGGCGCAGGCCGCGCCAAGGAACAAAAACGAAATCGCTTGCCCCCGGACCCGGCCACGGTGCTCCGTGGGCAACGCATTCTGTCGTATTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCATCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCACGCAACCCCCCACCCACGAGGTGGCCGGGTCTCGGGGGGCACACAATGGCCTCCCGTGCGCACCGTCGCGCGGATGGCTTAAATCCGAGTCCTCGGCGCCTGTCGTCGTGACACAACGGTGGTTGCATAACGAACCGCGTCGCGACCCCAGCCGCGCCACCATGAGGCCTCCCGTTGCAACACGCAACGACACCCCTCGAAGGCCGTCCACGACGGCTCTCTCGACGCGACCCCA

Click for details-----ITS1

Click for details-----ITS2

ATCGCTGCCCCCACGCAACCCCCCACCCACGAGGTGGCCGGGTCTCGGGGGGCACACAATGGCCTCCCGTGCGCACCGTCGCGCGGATGGCTTAAATCCGAGTCCTCGGCGCCTGTCGTCGTGACACAACGGTGGTTGCATAACGAACCGCGTCGCGACCCCAGCCGCGCCACCATGAGGCCTCCCGTTGCAACACGCAACGACACCCCTCGAAGGCCGTCCACGACGGCTCTCTCGACGCGACCCCA

Taxonomic Information

Plant ID: NPO11174
Plant Latin Name: Hemsleya Graciliflora
Taxonomy Genus: Hemsleya
Taxonomy Family: Cucurbitaceae

Plant External Links:

NCBI TaxonomyDB: 447117
Plant-of-the-World-Online: 292925-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC5497

Ingredient ID: NPC51443

Ingredient ID: NPC311120

Ingredient ID: NPC286342

Ingredient ID: NPC282439

Ingredient ID: NPC270465

Ingredient ID: NPC260895

Ingredient ID: NPC245584

Ingredient ID: NPC175381

Ingredient ID: NPC15598

Ingredient ID: NPC143427

Ingredient ID: NPC127555

Ingredient ID: NPC122513

Ingredient ID: NPC113733

Ingredient ID: NPC105727

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Protein Kinase	STK3	Serine/threonine-protein kinase MST2	Q13188	CHEMBL4708
Therapeutic Target	Protein Kinase	DYRK1B	Dual specificity tyrosine-phosphorylation-regulated kinase 1B	Q9Y463	CHEMBL5543
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	ACVR1	Activin receptor type-1	Q04771	CHEMBL5903
Therapeutic Target	Protein Kinase	FGFR1	Fibroblast growth factor receptor 1	P11362	CHEMBL3650
Therapeutic Target	Protein Kinase	JAK2	Tyrosine-protein kinase JAK2	O60674	CHEMBL2971
Therapeutic Target	Protein Kinase	CAMK2A	CaM kinase II alpha	Q9UQM7	CHEMBL4147
Therapeutic Target	Protein Kinase	MAP3K10	Mitogen-activated protein kinase kinase kinase 10	Q02779	CHEMBL2873
Therapeutic Target	Protein Kinase	MAP4K4	Mitogen-activated protein kinase kinase kinase kinase 4	O95819	CHEMBL6166
Therapeutic Target	Protein Kinase	MARK4	MAP/microtubule affinity-regulating kinase 4	Q96L34	CHEMBL5754
Therapeutic Target	Protein Kinase	CAMK1D	CaM kinase I delta	Q8IU85	CHEMBL5073
Therapeutic Target	Protein Kinase	ALK	ALK tyrosine kinase receptor	Q9UM73	CHEMBL4247
Therapeutic Target	Protein Kinase	CAMKK2	CaM-kinase kinase beta	Q96RR4	CHEMBL5284
Therapeutic Target	Protein Kinase	CSNK1A1	Casein kinase I alpha	P48729	CHEMBL2793
Therapeutic Target	Protein Kinase	RET	Tyrosine-protein kinase receptor RET	P07949	CHEMBL2041
Therapeutic Target	Protein Kinase	GRK5	G protein-coupled receptor kinase 5	P34947	CHEMBL5678
Therapeutic Target	Protein Kinase	BTK	Tyrosine-protein kinase BTK	Q06187	CHEMBL5251
Therapeutic Target	Protein Kinase	FLT1	Vascular endothelial growth factor receptor 1	P17948	CHEMBL1868
Therapeutic Target	Protein Kinase	PRKCQ	Protein kinase C theta	Q04759	CHEMBL3920
Therapeutic Target	Protein Kinase	SIK2	Serine/threonine-protein kinase SIK2	Q9H0K1	CHEMBL5699
Therapeutic Target	Protein Kinase	CDK6	Cyclin-dependent kinase 6	Q00534	CHEMBL2508
Therapeutic Target	Protein Kinase	MARK3	Serine/threonine-protein kinase c-TAK1	P27448	CHEMBL5600
Therapeutic Target	Protein Kinase	LRRK2	Leucine-rich repeat serine/threonine-protein kinase 2	Q5S007	CHEMBL1075104
Therapeutic Target	Protein Kinase	TNK2	Tyrosine kinase non-receptor protein 2	Q07912	CHEMBL4599
Therapeutic Target	Protein Kinase	ROCK2	Rho-associated protein kinase 2	O75116	CHEMBL2973
Therapeutic Target	Protein Kinase	ROS1	Proto-oncogene tyrosine-protein kinase ROS	P08922	CHEMBL5568
Therapeutic Target	Protein Kinase	CLK2	Dual specificity protein kinase CLK2	P49760	CHEMBL4225
Therapeutic Target	Protein Kinase	HCK	Tyrosine-protein kinase HCK	P08631	CHEMBL3234
Therapeutic Target	Protein Kinase	CDK8	Cell division protein kinase 8	P49336	CHEMBL5719
Therapeutic Target	Protein Kinase	TBK1	Serine/threonine-protein kinase TBK1	Q9UHD2	CHEMBL5408
Therapeutic Target	Protein Kinase	MAPK10	c-Jun N-terminal kinase 3	P53779	CHEMBL2637
Therapeutic Target	Protein Kinase	IKBKE	Inhibitor of nuclear factor kappa B kinase epsilon subunit	Q14164	CHEMBL3529
Therapeutic Target	Protein Kinase	LTK	Leukocyte tyrosine kinase receptor	P29376	CHEMBL5627
Therapeutic Target	Protein Kinase	SGK2	Serine/threonine-protein kinase Sgk2	Q9HBY8	CHEMBL5794
Therapeutic Target	Protein Kinase	MELK	Maternal embryonic leucine zipper kinase	Q14680	CHEMBL4578
Therapeutic Target	Protein Kinase	PRKX	Serine/threonine-protein kinase PRKX	P51817	CHEMBL5818
Therapeutic Target	Protein Kinase	DYRK1A	Dual-specificity tyrosine-phosphorylation regulated kinase 1A	Q13627	CHEMBL2292
Therapeutic Target	Protein Kinase	TYRO3	Tyrosine-protein kinase receptor TYRO3	Q06418	CHEMBL5314
Therapeutic Target	Protein Kinase	PTK2	Focal adhesion kinase 1	Q05397	CHEMBL2695

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	9

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Fisetin (NPC51443)	NP level
NCT04771611	COVFIS-HOME: COVID-19 Pilot Study of Fisetin to Alleviate Dysfunction and Decrease Complications	COVID-19	Fisetin (NPC51443)	NP level
NCT05416515	A Study of Fisetin to Treat Carpal Tunnel Syndrome	carpal tunnel syndrome	Fisetin (NPC51443)	NP level
NCT04770064	Targeting Senescence to Reduce Osteoarthritis Pain and cartilagE Breakdown (ROPE)	osteoarthritis, knee	Fisetin (NPC51443)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Fisetin (NPC51443)	NP level
NCT04210986	Senolytic Drugs Attenuate Osteoarthritis-Related Articular Cartilage Degeneration: A Clinical Trial	osteoarthritis, knee	Fisetin (NPC51443)	NP level
NCT04815902	Use of Senolytic and Anti-Fibrotic Agents to Improve the Beneficial Effect of Bone Marrow Stem Cells for Osteoarthritis	osteoarthritis, knee	Fisetin (NPC51443)	NP level
NCT04537299	COVID-FIS: Pilot in COVID-19 (SARS-CoV-2) of Fisetin in Older Adults in Nursing Homes	COVID-19;severe acute respiratory syndrome	Fisetin (NPC51443)	NP level
NCT04476953	COVID-FISETIN: Pilot in SARS-CoV-2 of Fisetin to Alleviate Dysfunction and Inflammation	COVID-19	Fisetin (NPC51443)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HCK,PRKCQ,BTK,SGK2,ACHE,CDK5R1,MAP3K10,RET,LTK
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	PRKCQ,JAK3,TBK1,ACHE,JAK2,RET,IKBKE,FLT1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	RET,FGFR1,PDGFRA,FLT1,CDK8,MELK,ACVR1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RET,FGFR1,ALK,PDGFRA,JAK2,ROS1,CDK6
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	RET,ALK,CDK6,MELK,FGFR1,ROS1,JAK2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	HCK,PRKCQ,BTK,NOX4,LRRK2,IKBKE,JAK3
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	PRKCQ,BTK,LTK,NOX4,CDK6,TYRO3,JAK3
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CCNB2,LTK,SGK2,ALK,ROS1,MELK,IKBKE
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HCK,BTK,APEX1,ACHE,CDK5R1,CAMK1D,IKBKE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	PRKCQ,CCNB2,NOX4,FGFR1,MELK,CAMK1D,JAK3
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	GSK3B,CDK8,FGFR1,BTK,PDGFRA,MELK
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	NOX4,ALK,ROS1,TYRO3,RET,LRRK2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CCNB2,SGK2,ACHE,CDK5R1,MELK,RET
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ROCK2,BTK,JAK2,CAMK2A,JAK3
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	FGFR1,FLT1,ACVR1,PDGFRA,RET
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	BTK,JAK3,CSNK1A1,JAK2,CLK2
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	ROS1,FGFR1,RET,FLT1,ALK
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CCNB2,NOX4,CDK6,ROS1,MELK
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CCNB2,PRKX,ALOX12,CDK5R1,MELK
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CCNB2,NOX4,ACHE,ROS1,MELK
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	HCK,PTK2,BTK,LRRK2,FLT1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CCNB2,LTK,CDK5R1,MELK,CAMK1D
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	HCK,BTK,NOX4,ALK,RET
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	FLT1,BTK,PTK2,JAK2
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FGFR1,JAK2,MELK,GSK3B
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	FGFR1,PDGFRA,FLT1,RET
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	SGK2,ALK,TNK2,CAMK2A
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CCNB2,ROS1,MELK,RET
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	HCK,CSNK2A3,BTK,PDGFRA
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE,LRRK2,GSK3B
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	MARK3,PTK2,FGFR1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	ROCK2,JAK3,CDK6
B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A86	JAK2,JAK3,BTK
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	FGFR1,ACHE,FLT1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	BTK,MELK,RET
Osteoarthritis of knee Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	NCT04815902,NCT04770064,NCT04210986
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04771611,NCT04476953,NCT04537299
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	JAK2,ACHE,JAK3
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	NOX4,ROS1,MELK
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	TYRO3,ACHE,PRKX
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CCNB2,ROS1,MELK
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	FGFR1,MAPK10
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	BTK,ALK
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	FGFR1,CSNK2A1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	BTK,JAK2
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	PDGFRA,JAK2
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ALK,ROS1
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	FLT1,FLT1
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	FLT1,FGFR1
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	ALK,ROS1
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	FLT1,FGFR1
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	JAK3,JAK2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	JAK2,JAK3
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	PDGFRA,CDK6
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	ROCK2 NOX4
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ROCK2,ACHE
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FGFR1,MAPK10
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	PTK2,FGFR1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	JAK3,JAK2
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	FLT1,APEX1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	BTK,ROCK2
Alopecia Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED70	JAK3,JAK2
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	BTK,MELK
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	JAK2,MELK
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	LRRK2,NOX4
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CDK6,MELK
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	NOX4,TYRO3
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	MELK,CCNB2
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	CAMKK2,NOX4
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	TYRO3,CAMK2A
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	CDK8,CDK6
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MAPK10,ACHE
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CCNB2,CSNK2A2,NOX4,MAPK10,MELK,CSNK2A1,TYRO3,ROCK2,CDK8,CDK6,APEX1,FGFR1,IKBKE,PDGFRA,ALK,PTK2,ACHE,CDK5R1,FLT1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	ROS1,ACVR1,GSK3B,CDK6,MARK3,APEX1,FLT1,PDGFRA,JAK2,PTK2,RET,MAPK10,TYRO3,ALK,FGFR1,BTK,CSNK1A1,CSNK2A1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	HCK,PRKCQ,TYRO3,JAK3,BTK,CSNK2A2,MAP4K4,PRKX,ALK,CDK6,APEX1,ROS1,ACVR1,MELK,CAMK1D,RET,IKBKE
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,BTK,NOX4,ROS1,CAMK1D,CSNK2A1,ALOX12,APEX1,RET,IKBKE,HCK,ALK,DYRK1B,PRKCQ,PRKX,LTK
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	MELK,CLK2,CSNK2A1,CSNK2A3,TYRO3,CCNB2,NOX4,PRKX,ALOX12,DYRK1B,MAPK10,CDK5R1,FGFR1,MAP3K10,IKBKE,JAK3
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	BTK,NOX4,TNK2,MELK,CAMK2A,ALOX12,CDK6,FGFR1,MAP4K4,RET,GRK5,JAK3,HCK,PRKX,ACHE,ACVR1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HCK,PRKCQ,LTK,MAP4K4,PRKX,ALK,CDK6,DYRK1B,ROS1,CDK5R1,MELK,RET,IKBKE,JAK3
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	JAK3,BTK,CCNB2,ALK,ACHE,MELK,LRRK2,HCK,JAK3,BTK,CCNB2,ALK,MELK,FLT1
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	PRKCQ,CAMK2A,TYRO3,CCNB2,NOX4,PRKX,ALK,CDK6,CDK5R1,FGFR1,MELK,MAP4K4,IKBKE
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HCK,BTK,LTK,ALK,ACHE,ROS1,CDK5R1,MELK,GRK5,CSNK1A1,IKBKE,JAK3
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACVR1,CAMK2A,CAMK1D,NOX4,ALK,ACHE,CDK5R1,FGFR1,MARK4,RET,FLT1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	PRKCQ,CAMK2A,BTK,PDGFRA,NOX4,ALK,FGFR1,RET,GRK5 NCT05416515
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CAMK2A,TYRO3,CCNB2,NOX4,ROS1,CDK5R1,MELK,MELK,CCNB2,MAP4K4
Cutaneous lupus erythematosus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EB50-EB5Z	MAPK10
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	ALK
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Thrombocytosis Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B63	JAK2
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	FGFR1
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	GSK3B
Psoriatic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA21	ROCK2
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Spontaneous urticaria Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EB00	BTK
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	FGFR1
Anemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A00-3A9Z	ACVR1
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	PDGFRA
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	BTK
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PRKCQ
Pruritus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EC90	JAK3
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	PTK2
Kaposi sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B57	PDGFRA
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	FGFR1
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	FLT1
Coronary atherosclerosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA80	FGFR1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	JAK3
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	PDGFRA
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CDK6
Pemphigus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EB40	BTK
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	FGFR1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	JAK2
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	RET
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	PDGFRA
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	PTK2
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	FLT1
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	BTK
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	MAPK10
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RET
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	RET
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT05276895
Severe acute respiratory syndrome Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D65	NCT04537299
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	RET
Intrauterine growth restriction Disease Category: 19.Certain conditions originating in the perinatal period Disease ICD-11 Code: KA20.1	FLT1
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	LTK
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	FLT1
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	MELK

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Hemsleya Graciliflora

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

15 All known Ingredients in Total

13 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Cytomegaloviral disease

West Nile virus infection

Myelodysplastic syndrome

Lung cancer

Breast cancer

Leishmaniasis

Melanoma of skin

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Malignant neoplasms of adrenal gland

Acute myeloid leukaemia

Malignant neoplasms of thyroid gland, unspecified

Adenocarcinoma of bronchus or lung

Rheumatoid arthritis

Multiple myeloma

Malignant haematopoietic neoplasm

Colorectal cancer

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of oesophagus

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Renal cell carcinoma, chromophobe type

Gliomas of brain

Pancreatic cancer

Myeloproliferative neoplasm

Thrombocytopenia

Myelodysplastic syndromes, unspecified

Invasive carcinoma of breast

Glioblastoma of brain

Parkinsonism

Peritoneal cancer

Psoriasis

B-cell lymphoma

Alzheimer disease

Mature B-cell lymphoma

Osteoarthritis of knee

COVID-19

Zika virus disease

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Type 2 diabetes mellitus

Diffuse large B-cell lymphoma

Liver cancer

Multiple sclerosis

BCR-ABL1-negative chronic myeloid leukaemia

Adrenal cancer

Chronic arterial occlusive disease

Bladder cancer

Non-small cell lung cancer

Stomach cancer

Acquired hypomelanotic disorder

Atopic eczema

Brain cancer

Systemic sclerosis

Glaucoma

Idiopathic interstitial pneumonitis

Ovarian cancer

Asthma

Retinopathy

Lupus erythematosus

Alopecia