• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hemsleya Graciliflora


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGATGCCTAAACATCAGAACGACCCGCGAACATGTTCAACAACCCGGGGCGTGGCGGTCCGAGAGGGCCGCCCCGTCCCTCCCCCGCACCGGTGGTCGGGGCCGCGCCTCCAGCGTGCGCCCCAGCCCCGTCACGGGTAACCAAACCCCGGCGCAGGCCGCGCCAAGGAACAAAAACGAAATCGCTTGCCCCCGGACCCGGCCACGGTGCTCCGTGGGCAACGCATTCTGTCGTATTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCATCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCACGCAACCCCCCACCCACGAGGTGGCCGGGTCTCGGGGGGCACACAATGGCCTCCCGTGCGCACCGTCGCGCGGATGGCTTAAATCCGAGTCCTCGGCGCCTGTCGTCGTGACACAACGGTGGTTGCATAACGAACCGCGTCGCGACCCCAGCCGCGCCACCATGAGGCCTCCCGTTGCAACACGCAACGACACCCCTCGAAGGCCGTCCACGACGGCTCTCTCGACGCGACCCCA

Click for details-----ITS1

TTGTCGATGCCTAAACATCAGAACGACCCGCGAACATGTTCAACAACCCGGGGCGTGGCGGTCCGAGAGGGCCGCCCCGTCCCTCCCCCGCACCGGTGGTCGGGGCCGCGCCTCCAGCGTGCGCCCCAGCCCCGTCACGGGTAACCAAACCCCGGCGCAGGCCGCGCCAAGGAACAAAAACGAAATCGCTTGCCCCCGGACCCGGCCACGGTGCTCCGTGGGCAACGCATTCTGTCGTATTCACAA

Click for details-----ITS2

ATCGCTGCCCCCACGCAACCCCCCACCCACGAGGTGGCCGGGTCTCGGGGGGCACACAATGGCCTCCCGTGCGCACCGTCGCGCGGATGGCTTAAATCCGAGTCCTCGGCGCCTGTCGTCGTGACACAACGGTGGTTGCATAACGAACCGCGTCGCGACCCCAGCCGCGCCACCATGAGGCCTCCCGTTGCAACACGCAACGACACCCCTCGAAGGCCGTCCACGACGGCTCTCTCGACGCGACCCCA
Taxonomic Information

Plant ID: NPO11174
Plant Latin Name: Hemsleya Graciliflora
Taxonomy Genus: Hemsleya
Taxonomy Family: Cucurbitaceae

Plant External Links:

NCBI TaxonomyDB: 447117
Plant-of-the-World-Online: 292925-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC5497

Ingredient ID: NPC51443

Ingredient ID: NPC311120

Ingredient ID: NPC286342

Ingredient ID: NPC282439

Ingredient ID: NPC270465

Ingredient ID: NPC260895

Ingredient ID: NPC245584

Ingredient ID: NPC175381

Ingredient ID: NPC15598

Ingredient ID: NPC143427

Ingredient ID: NPC127555

Ingredient ID: NPC122513

Ingredient ID: NPC113733

Ingredient ID: NPC105727