• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Akebia Trifoliata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCCGACAGGACCCCCGTGAACTATCGATGCAAAAGATCGTCCGAGGAGGGGGCGTCGTGCGAACGACGATCCCCTCTCTCGTCGTGCCGCGAGCCCTGCCCGGATCGTCGGCGCGGATCCGATCCGTGCCGCGGTGCCCGCCGTCCTCGCGGTCCCGAATTAACAACGTATCCCCGGCGCGAACAGCGTCAAGGAAATTTCACAAGGTGCGCGTCCCCCCGGTGCGTCCGCGGGCGACGTCGCGATCCTGATATTATTCGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAGGCCATTAGGCTGAGGGCACGTCTGCCTGGGCGTCAAGCATCGCGTCACCCCCCGACTCCGTCGTCTCGGAGCCGCGCGGGTGGAGATTGGCCCCCCGTGCGTCGCGCGGTCGGCCCAAAAACGAGCCCTTGACGGCCAGTGTCACGATCAGTGGTGGTTGACGTGCCTCTTTCCGGAGATGGATGTCGTGCCCGCTGCGTCGTCAAACGGGCCACGCGGACCTTTTCGGTGCTCACGGAGCACTCGTCCTGCGACCCC

Click for details-----ITS1

TCGAAACCTGCCCCGACAGGACCACCCGTGAACTATCGATGCAAAAGATCGTCCGGGGAGGGGCGTCGTGCGAACGGCGATCCCCTCTCTCGTCGTGCCGCGAGCCCTGCCCGGATCGTCGGCGCGGATCCGATCCGTGCCGCGGTGCCCGCCGTCCTCGCGGTCCCGAATTAACAACGTATCCCCGGCGCGAACAGCGTCAAGGAAATTTCACAAGGTGCGCGTCCCCCCGGCGAGTCCGCGGGCGACGTCGCGATCCTGATATTATTCGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO11170
Plant Latin Name: Akebia Trifoliata
Taxonomy Genus: Akebia
Taxonomy Family: Lardizabalaceae

Plant External Links:

NCBI TaxonomyDB: 155132
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antibacterial; Antifungal; Antiinflammatory; Antitumor; Blood tonic; Cardiotonic; Diuretic; Emmenagogue; Galactogogue

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

225 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


193 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

132 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC96630

Ingredient ID: NPC95675

Ingredient ID: NPC94368

Ingredient ID: NPC91962

Ingredient ID: NPC91574

Ingredient ID: NPC90701

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC86954

Ingredient ID: NPC85813

Ingredient ID: NPC85661

Ingredient ID: NPC84030

Ingredient ID: NPC82295

Ingredient ID: NPC78551

Ingredient ID: NPC78500

Ingredient ID: NPC78479

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC75121

Ingredient ID: NPC7491

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC69271

Ingredient ID: NPC68889

Ingredient ID: NPC66681

Ingredient ID: NPC66577

Ingredient ID: NPC63704

Ingredient ID: NPC59581

Ingredient ID: NPC59570

Ingredient ID: NPC58970

Ingredient ID: NPC58478

Ingredient ID: NPC57879

Ingredient ID: NPC57877

Ingredient ID: NPC56112

Ingredient ID: NPC55181

Ingredient ID: NPC54264

Ingredient ID: NPC53720

Ingredient ID: NPC52700

Ingredient ID: NPC52403

Ingredient ID: NPC52309

Ingredient ID: NPC49151

Ingredient ID: NPC46679

Ingredient ID: NPC45270

Ingredient ID: NPC44751

Ingredient ID: NPC42471

Ingredient ID: NPC42403

Ingredient ID: NPC41180

Ingredient ID: NPC40249

Ingredient ID: NPC39633

Ingredient ID: NPC39068

Ingredient ID: NPC38497

Ingredient ID: NPC37644

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC323787

Ingredient ID: NPC32279

Ingredient ID: NPC315507

Ingredient ID: NPC312132

Ingredient ID: NPC310478

Ingredient ID: NPC309982

Ingredient ID: NPC309606

Ingredient ID: NPC308218

Ingredient ID: NPC303979

Ingredient ID: NPC303683

Ingredient ID: NPC302857

Ingredient ID: NPC302327

Ingredient ID: NPC301964

Ingredient ID: NPC301696

Ingredient ID: NPC301344

Ingredient ID: NPC298978

Ingredient ID: NPC297608

Ingredient ID: NPC2957

Ingredient ID: NPC29561

Ingredient ID: NPC295492

Ingredient ID: NPC295442

Ingredient ID: NPC294136

Ingredient ID: NPC292792

Ingredient ID: NPC291255

Ingredient ID: NPC290923

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC287597

Ingredient ID: NPC287550

Ingredient ID: NPC287331

Ingredient ID: NPC285716

Ingredient ID: NPC28545

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC282694

Ingredient ID: NPC282055

Ingredient ID: NPC279895

Ingredient ID: NPC279300

Ingredient ID: NPC279026

Ingredient ID: NPC277569

Ingredient ID: NPC275462

Ingredient ID: NPC274681

Ingredient ID: NPC273770

Ingredient ID: NPC273545

Ingredient ID: NPC272756

Ingredient ID: NPC270768

Ingredient ID: NPC26906

Ingredient ID: NPC268098

Ingredient ID: NPC264779

Ingredient ID: NPC262505

Ingredient ID: NPC261080

Ingredient ID: NPC259134

Ingredient ID: NPC257124

Ingredient ID: NPC255662

Ingredient ID: NPC255042

Ingredient ID: NPC25275

Ingredient ID: NPC252067

Ingredient ID: NPC251666

Ingredient ID: NPC248233

Ingredient ID: NPC246543

Ingredient ID: NPC242163

Ingredient ID: NPC240817

Ingredient ID: NPC239039

Ingredient ID: NPC237314

Ingredient ID: NPC236602

Ingredient ID: NPC23508

Ingredient ID: NPC235059

Ingredient ID: NPC234231

Ingredient ID: NPC233533

Ingredient ID: NPC232926

Ingredient ID: NPC232247

Ingredient ID: NPC231738

Ingredient ID: NPC230336

Ingredient ID: NPC223468

Ingredient ID: NPC220089

Ingredient ID: NPC219969

Ingredient ID: NPC219550

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC213449

Ingredient ID: NPC210040

Ingredient ID: NPC209275

Ingredient ID: NPC209166

Ingredient ID: NPC208936

Ingredient ID: NPC208075

Ingredient ID: NPC207844

Ingredient ID: NPC207115

Ingredient ID: NPC206095

Ingredient ID: NPC201844

Ingredient ID: NPC199958

Ingredient ID: NPC196711

Ingredient ID: NPC196490

Ingredient ID: NPC196442

Ingredient ID: NPC196434

Ingredient ID: NPC194944

Ingredient ID: NPC193180

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC187061

Ingredient ID: NPC186098

Ingredient ID: NPC185189

Ingredient ID: NPC182840

Ingredient ID: NPC181089

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC179831

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176309

Ingredient ID: NPC175342

Ingredient ID: NPC174679

Ingredient ID: NPC174368

Ingredient ID: NPC174365

Ingredient ID: NPC17408

Ingredient ID: NPC173996

Ingredient ID: NPC171063

Ingredient ID: NPC169222

Ingredient ID: NPC168855

Ingredient ID: NPC167976

Ingredient ID: NPC167385

Ingredient ID: NPC166894

Ingredient ID: NPC1656

Ingredient ID: NPC163984

Ingredient ID: NPC163520

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC160996

Ingredient ID: NPC156750

Ingredient ID: NPC155263

Ingredient ID: NPC154466

Ingredient ID: NPC153958

Ingredient ID: NPC152438

Ingredient ID: NPC150212

Ingredient ID: NPC150031

Ingredient ID: NPC149193

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC142753

Ingredient ID: NPC142415

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC13789

Ingredient ID: NPC137425

Ingredient ID: NPC136165

Ingredient ID: NPC135648

Ingredient ID: NPC135388

Ingredient ID: NPC135077

Ingredient ID: NPC133600

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC128825

Ingredient ID: NPC125144

Ingredient ID: NPC122487

Ingredient ID: NPC122086

Ingredient ID: NPC119381

Ingredient ID: NPC114239

Ingredient ID: NPC109813

Ingredient ID: NPC108218

Ingredient ID: NPC106250

Ingredient ID: NPC105329

Ingredient ID: NPC105171

Ingredient ID: NPC104323

Ingredient ID: NPC101285