• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Piper Cubeba


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGATGCCCATCTTAACAAGACAGACGGAAGCGAACTTGTGAACCCTCGTGTTCTTGGCCCGCACGTCGGGGCGGCGCTCTGCGCGTGTCGGGCAGACGACGAACCAAATCTCGGCGCAGGACGCGCCAAGCAACTCGGGAAGCTTTGATTGCGGCATCCTCTTCCCTGTCGGGCTGGAGGGCACGCATCGAACACTCACAAGTCAGTACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTCGGTCGAGGGCACATCTGCTTGGGCGTTAAACAACTCGTCCCCCGCCTCCTTCCCCCCCCCGCACGCTCCGAGCGAGGGGCCTGTCGGAGATGAGGGTAGGTCGGGCGGAGTCTGGTCGTCCGTGTGCCTGCAGCGCATGCGGTCGGCTGAAAAGGCAGGGCCATGGGCTGCGTGCGGCCCAACGAGTGGTGGTTGTGCGCCCTCGCGAGGCCGCGATTGTCGGCGCGTTGGGCCGTGCGCTCCTCGATTGCCCGGCAAGTACCCGACACGATCGAAACATCGATTCGAA

Click for details-----ITS1

TTGATGCCCATCTTAACAAGACAGACGGAAGCGAACTTGTGAACCCTCGTGTTCTTGGCCCGCACGTCGGGGCGGCGCTCTGCGCGTGTCGGGCAGACGACGAACCAAATCTCGGCGCAGGACGCGCCAAGCAACTCGGGAAGCTTTGATTGCGGCATCCTCCTCCCTGTCGGGCTGGGGGGGCACGCATCGAACACTTACAATTCAGTA

Click for details-----ITS2

AACTCGTCCCCCGCCTCCTTCCCCCCCCCGCACGCTCCGAGCGAGGGGCCTGTCGGAGATGAGGGTAGGTCGGGCGGAGTCTGGTCGTCCGTGTGCCTGCAGCGCATGCGGTCGGCTGAAAAGGCAGGGCCATGGGCTGCGTGCGGCCCAACGAGTGGTGGTTGTGCGCCCTCGCGAGGCCGCGATTGTCGGCGCGTTGGGCCGTGCGCTCCTCGATTGCCCGGCAAGTACCCGACACGATCGAAACATCGATTCGAA
Taxonomic Information

Plant ID: NPO11169
Plant Latin Name: Piper Cubeba
Taxonomy Genus: Piper
Taxonomy Family: Piperaceae

Plant External Links:

NCBI TaxonomyDB: 405322
Plant-of-the-World-Online: 681071-1

Used in Medicines

Country/Region:
Jordan; Indonesia; India; China; Iraq

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

Myanmar; Indonesia; India; Jordan; China; Iraq

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

189 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


177 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

98 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99572

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC95675

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC85665

Ingredient ID: NPC84824

Ingredient ID: NPC79858

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC72796

Ingredient ID: NPC72775

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC67508

Ingredient ID: NPC66577

Ingredient ID: NPC64357

Ingredient ID: NPC64176

Ingredient ID: NPC61828

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC59815

Ingredient ID: NPC57877

Ingredient ID: NPC54264

Ingredient ID: NPC52464

Ingredient ID: NPC51189

Ingredient ID: NPC49074

Ingredient ID: NPC48764

Ingredient ID: NPC47946

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC43822

Ingredient ID: NPC43114

Ingredient ID: NPC41348

Ingredient ID: NPC40352

Ingredient ID: NPC40249

Ingredient ID: NPC38497

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC3155

Ingredient ID: NPC31279

Ingredient ID: NPC309182

Ingredient ID: NPC308218

Ingredient ID: NPC307011

Ingredient ID: NPC304079

Ingredient ID: NPC301195

Ingredient ID: NPC300649

Ingredient ID: NPC29988

Ingredient ID: NPC299235

Ingredient ID: NPC297844

Ingredient ID: NPC297643

Ingredient ID: NPC297527

Ingredient ID: NPC296337

Ingredient ID: NPC294136

Ingredient ID: NPC293757

Ingredient ID: NPC291100

Ingredient ID: NPC290189

Ingredient ID: NPC289366

Ingredient ID: NPC288991

Ingredient ID: NPC288932

Ingredient ID: NPC287660

Ingredient ID: NPC287446

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC284731

Ingredient ID: NPC283949

Ingredient ID: NPC283655

Ingredient ID: NPC276009

Ingredient ID: NPC275706

Ingredient ID: NPC274681

Ingredient ID: NPC273657

Ingredient ID: NPC270087

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268564

Ingredient ID: NPC265960

Ingredient ID: NPC257124

Ingredient ID: NPC256651

Ingredient ID: NPC255042

Ingredient ID: NPC25275

Ingredient ID: NPC252230

Ingredient ID: NPC249407

Ingredient ID: NPC248726

Ingredient ID: NPC24824

Ingredient ID: NPC246165

Ingredient ID: NPC242711

Ingredient ID: NPC239039

Ingredient ID: NPC236602

Ingredient ID: NPC236522

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC229262

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC226547

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC221733

Ingredient ID: NPC22098

Ingredient ID: NPC220221

Ingredient ID: NPC218918

Ingredient ID: NPC215632

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC213711

Ingredient ID: NPC211386

Ingredient ID: NPC210831

Ingredient ID: NPC210560

Ingredient ID: NPC210354

Ingredient ID: NPC210316

Ingredient ID: NPC209275

Ingredient ID: NPC204242

Ingredient ID: NPC200370

Ingredient ID: NPC200066

Ingredient ID: NPC19890

Ingredient ID: NPC198658

Ingredient ID: NPC198586

Ingredient ID: NPC197942

Ingredient ID: NPC196937

Ingredient ID: NPC196711

Ingredient ID: NPC196490

Ingredient ID: NPC195246

Ingredient ID: NPC190810

Ingredient ID: NPC190771

Ingredient ID: NPC189248

Ingredient ID: NPC189036

Ingredient ID: NPC188334

Ingredient ID: NPC188238

Ingredient ID: NPC185908

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC178777

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC175987

Ingredient ID: NPC173996

Ingredient ID: NPC17380

Ingredient ID: NPC173228

Ingredient ID: NPC171550

Ingredient ID: NPC168351

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165651

Ingredient ID: NPC16157

Ingredient ID: NPC160996

Ingredient ID: NPC158737

Ingredient ID: NPC157944

Ingredient ID: NPC155182

Ingredient ID: NPC154466

Ingredient ID: NPC150809

Ingredient ID: NPC148303

Ingredient ID: NPC14682

Ingredient ID: NPC145373

Ingredient ID: NPC144023

Ingredient ID: NPC143649

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC135257

Ingredient ID: NPC134764

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC131431

Ingredient ID: NPC126240

Ingredient ID: NPC12319

Ingredient ID: NPC120926

Ingredient ID: NPC118617

Ingredient ID: NPC11489

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC110958

Ingredient ID: NPC109813

Ingredient ID: NPC106250

Ingredient ID: NPC102091

Ingredient ID: NPC101285

Ingredient ID: NPC100502

Ingredient ID: NPC100445