• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Centella Asiatica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAACAGGTTTCGGTAGTGAACTTGGGAAGGATCATTGTCGAAACCTGCACCGCAGAACGACCCGCGAACACGTAAAGCAACACGGGGCGAGCGGCTCCCGGGGCGCAAGCCCCTCGCGCCGCGAACCCACGGACGGGGTCCTCCCTCGGGCGTCCCCCGTCCGGCTAACCAACCCCGGCGCGGCAAGCGCCAAGGAATTAAAAACCGAACGAGGCCGTCTCTCCCCCGTTCGCGGGCGGCGGAGGCGTCTTGTCCTAAAAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCACCCGTCGGCCTCGAAAGGGGTCGGGGCGGAGGGGCGGAGAATGGCCTCCCGTGCCTCGGGGCGCGGTTGGCCCAAACGTCAGCCCGCGGCGACGGACGTCACGACAAGTGGTGGTTTGACAAAGGCCCTCGCATGTTGTCGTGCGGTGATCCGTCGTCGGCGTGAGCTCGTGCGACCCTGTTGCCACGCCGTGCTCGGCGCGCGCTCCGA

Click for details-----ITS1

GTAACAGGTTTCGGTAGTGAACTTGGGAAGGATCATTGTCGAAACCTGCACCGCAGAACGACCCGCGAACACGTAAAGCAACACGGGGCGAGCGGCTCCCGGGGCGCAAGCCCCTCGCGCCGCGAACCCACGGACGGGGTCCTCCCTCGGGCGTCCCCCGTCCGGCTAACCAACCCCGGCGCGGCAAGCGCCAAGGAATTAAAAACCGAACGAGGCCGTCTCTCCCCCGTTCGCGGGCGGCGGAGGCGTCTTGTCCTAAAAACAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCCCACCCGTCGACCTCGAAAGGGGTCGGGGCGGAGGGGCGGAGAATGGCCTCCCGTGCCTCGGGGCGCGGTTGGCCCAAACGTCAGCCCGCGGCGACGGACGTCACGACAAGTGGTGGTTTGACAAAGGCCCTCGCATGTTGTCGTGCGGTGATCCGTCGTCGGCGTGAGCTCGTGCGACCCTGTTGCCACGCCGTGCTCGGCGCGCGCTCCGACCGCGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO11144
Plant Latin Name: Centella Asiatica
Taxonomy Genus: Centella
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48106
Plant-of-the-World-Online: 1197718-2

Used in Medicines

Country/Region:
Madagascar; Angola; South Africa; Thailand; Tanzania; Indonesia; India; Malaysia; Zimbabwe; Rwanda; Vietnam; Swaziland; Laos; Kenya; China; Philippines

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Adaptogen; Anticonvulsant; Antidiarrhoeal; Antiinflammatory; Antipanic; Antirheumatic; Cardiac; Depurative; Diuretic; Febrifuge; Hypotensive; Nervine; Sedative; Skin; Tonic

Geographical Distribution

Brazil; Madagascar; Bangladesh; Liberia; Sudan; Guinea; Mali; Cambodia; Malawi; Ethiopia; Rwanda; Tanzania; Somalia; Swaziland; Laos; Nigeria; Cameroon; Burkina Faso; Benin; Ghana; Australia; Iran; Malaysia; Thailand; Zambia; Cape Verde; Cote d'Ivoire; Togo; Zimbabwe; China; Germany; Belize; United States; Sierra Leone; Eritrea; Nepal; Uganda; Taiwan; Gambia; Philippines; Indonesia; New Caledonia; Mauritius; Sri Lanka; Mauritania; Vietnam; Gabon; Guinea-Bissau; Kenya; Namibia; New Zealand; Russia; Pakistan; Seychelles; Angola; Myanmar; Chad; Equatorial Guinea; South Africa; India; Botswana; Lesotho; Senegal; Congo; Mozambique; Colombia; Burundi; Japan; Niger; Fiji; Comoros

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

253 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


94 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

105 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98661

Ingredient ID: NPC94442

Ingredient ID: NPC93974

Ingredient ID: NPC92143

Ingredient ID: NPC91757

Ingredient ID: NPC90096

Ingredient ID: NPC88971

Ingredient ID: NPC88278

Ingredient ID: NPC87828

Ingredient ID: NPC87132

Ingredient ID: NPC87015

Ingredient ID: NPC86412

Ingredient ID: NPC86093

Ingredient ID: NPC84842

Ingredient ID: NPC83470

Ingredient ID: NPC82705

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC80702

Ingredient ID: NPC80600

Ingredient ID: NPC8039

Ingredient ID: NPC74119

Ingredient ID: NPC73318

Ingredient ID: NPC71074

Ingredient ID: NPC708

Ingredient ID: NPC70744

Ingredient ID: NPC70388

Ingredient ID: NPC67446

Ingredient ID: NPC66577

Ingredient ID: NPC65871

Ingredient ID: NPC65823

Ingredient ID: NPC64434

Ingredient ID: NPC64261

Ingredient ID: NPC62767

Ingredient ID: NPC62086

Ingredient ID: NPC61477

Ingredient ID: NPC61

Ingredient ID: NPC58575

Ingredient ID: NPC57877

Ingredient ID: NPC56035

Ingredient ID: NPC54747

Ingredient ID: NPC52021

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC47132

Ingredient ID: NPC41961

Ingredient ID: NPC41518

Ingredient ID: NPC4081

Ingredient ID: NPC38203

Ingredient ID: NPC37250

Ingredient ID: NPC37208

Ingredient ID: NPC36408

Ingredient ID: NPC36275

Ingredient ID: NPC35299

Ingredient ID: NPC34338

Ingredient ID: NPC32977

Ingredient ID: NPC329440

Ingredient ID: NPC328774

Ingredient ID: NPC328685

Ingredient ID: NPC326717

Ingredient ID: NPC323890

Ingredient ID: NPC323831

Ingredient ID: NPC323324

Ingredient ID: NPC322307

Ingredient ID: NPC320603

Ingredient ID: NPC320124

Ingredient ID: NPC318631

Ingredient ID: NPC318439

Ingredient ID: NPC318102

Ingredient ID: NPC315507

Ingredient ID: NPC312800

Ingredient ID: NPC312553

Ingredient ID: NPC307282

Ingredient ID: NPC305464

Ingredient ID: NPC304434

Ingredient ID: NPC304431

Ingredient ID: NPC304309

Ingredient ID: NPC302857

Ingredient ID: NPC300351

Ingredient ID: NPC299912

Ingredient ID: NPC29838

Ingredient ID: NPC29641

Ingredient ID: NPC296355

Ingredient ID: NPC294906

Ingredient ID: NPC294902

Ingredient ID: NPC293203

Ingredient ID: NPC290613

Ingredient ID: NPC290365

Ingredient ID: NPC290229

Ingredient ID: NPC29

Ingredient ID: NPC289366

Ingredient ID: NPC288963

Ingredient ID: NPC288956

Ingredient ID: NPC288932

Ingredient ID: NPC28811

Ingredient ID: NPC28657

Ingredient ID: NPC284948

Ingredient ID: NPC283700

Ingredient ID: NPC283452

Ingredient ID: NPC282294

Ingredient ID: NPC281254

Ingredient ID: NPC278032

Ingredient ID: NPC277561

Ingredient ID: NPC27717

Ingredient ID: NPC276610

Ingredient ID: NPC272508

Ingredient ID: NPC271535

Ingredient ID: NPC269349

Ingredient ID: NPC268814

Ingredient ID: NPC268703

Ingredient ID: NPC268164

Ingredient ID: NPC266931

Ingredient ID: NPC264317

Ingredient ID: NPC263548

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC261548

Ingredient ID: NPC26144

Ingredient ID: NPC259166

Ingredient ID: NPC258892

Ingredient ID: NPC25848

Ingredient ID: NPC24983

Ingredient ID: NPC248222

Ingredient ID: NPC247276

Ingredient ID: NPC244398

Ingredient ID: NPC243728

Ingredient ID: NPC243339

Ingredient ID: NPC241110

Ingredient ID: NPC238811

Ingredient ID: NPC236381

Ingredient ID: NPC235260

Ingredient ID: NPC234617

Ingredient ID: NPC232880

Ingredient ID: NPC231738

Ingredient ID: NPC230896

Ingredient ID: NPC230301

Ingredient ID: NPC228633

Ingredient ID: NPC227806

Ingredient ID: NPC226141

Ingredient ID: NPC225710

Ingredient ID: NPC224389

Ingredient ID: NPC223602

Ingredient ID: NPC221435

Ingredient ID: NPC219876

Ingredient ID: NPC216858

Ingredient ID: NPC216630

Ingredient ID: NPC216053

Ingredient ID: NPC215926

Ingredient ID: NPC215624

Ingredient ID: NPC213749

Ingredient ID: NPC213572

Ingredient ID: NPC213538

Ingredient ID: NPC213152

Ingredient ID: NPC211694

Ingredient ID: NPC210831

Ingredient ID: NPC209970

Ingredient ID: NPC20924

Ingredient ID: NPC209166

Ingredient ID: NPC20791

Ingredient ID: NPC20645

Ingredient ID: NPC206095

Ingredient ID: NPC201844

Ingredient ID: NPC201018

Ingredient ID: NPC20006

Ingredient ID: NPC194842

Ingredient ID: NPC193976

Ingredient ID: NPC19376

Ingredient ID: NPC19323

Ingredient ID: NPC192638

Ingredient ID: NPC189224

Ingredient ID: NPC188591

Ingredient ID: NPC188341

Ingredient ID: NPC184937

Ingredient ID: NPC18074

Ingredient ID: NPC179950

Ingredient ID: NPC179114

Ingredient ID: NPC178370

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC174560

Ingredient ID: NPC174213

Ingredient ID: NPC173691

Ingredient ID: NPC173637

Ingredient ID: NPC170814

Ingredient ID: NPC170526

Ingredient ID: NPC170380

Ingredient ID: NPC169007

Ingredient ID: NPC167976

Ingredient ID: NPC166625

Ingredient ID: NPC163339

Ingredient ID: NPC162742

Ingredient ID: NPC159036

Ingredient ID: NPC159034

Ingredient ID: NPC158371

Ingredient ID: NPC158059

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC156353

Ingredient ID: NPC155763

Ingredient ID: NPC154172

Ingredient ID: NPC15284

Ingredient ID: NPC149072

Ingredient ID: NPC145667

Ingredient ID: NPC144590

Ingredient ID: NPC143889

Ingredient ID: NPC142703

Ingredient ID: NPC141855

Ingredient ID: NPC14157

Ingredient ID: NPC13818

Ingredient ID: NPC138113

Ingredient ID: NPC136188

Ingredient ID: NPC134835

Ingredient ID: NPC133671

Ingredient ID: NPC133642

Ingredient ID: NPC133506

Ingredient ID: NPC133458

Ingredient ID: NPC133404

Ingredient ID: NPC133166

Ingredient ID: NPC131769

Ingredient ID: NPC130278

Ingredient ID: NPC130216

Ingredient ID: NPC129088

Ingredient ID: NPC12725

Ingredient ID: NPC126029

Ingredient ID: NPC125306

Ingredient ID: NPC123965

Ingredient ID: NPC122318

Ingredient ID: NPC121788

Ingredient ID: NPC121648

Ingredient ID: NPC120625

Ingredient ID: NPC120123

Ingredient ID: NPC117691

Ingredient ID: NPC116775

Ingredient ID: NPC11666

Ingredient ID: NPC114270

Ingredient ID: NPC114269

Ingredient ID: NPC114239

Ingredient ID: NPC113928

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC112945

Ingredient ID: NPC112454

Ingredient ID: NPC112389

Ingredient ID: NPC112366

Ingredient ID: NPC109821

Ingredient ID: NPC109813

Ingredient ID: NPC109731

Ingredient ID: NPC109503

Ingredient ID: NPC109114

Ingredient ID: NPC108709

Ingredient ID: NPC1075

Ingredient ID: NPC101744

Ingredient ID: NPC100551