• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Salta Triflora


Example Image
PLANiTS DNA barcode

Click for details-----ITS

RACGCGAACTCGTTTATAAAAACCTCGGGGAGGCAGGGCTCGTCCCTGTCCCTCGAAACCGGCGTGTTCCTTCCCCATCTCCCTTGCAAGGGGGCGATGGGTGGGAGCACGTCGGCATGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAACAATTCTATCGCGTCCCGCCTCCCTCGGGCGACCGAGGGGGGTCGGCGATGGCGTGTCGATATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGYGTCGCCCCCTCCCACCCCATCTGGGACTGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCCGCGCGCGGTCGGCCTAAATACGGAGCCTGCGGCCGCAAATGCCGCGACGATTGGTGGTTGAAGCATCGCGTCGCGTGCTCGAGCGGACTACCCAGAGCTCGGAGGACCCT

Click for details-----ITS1

RACGCGAACTCGTTTATAAAAACCTCGGGGAGGCAGGGCTCGTCCCTGTCCCTCGAAACCGGCGTGTTCCTTCCCCATCTCCCTTGCAAGGGGGCGATGGGTGGGAGCACGTCGGCATGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAACAATTCTATCGCGTCCCGCCTCCCTCGGGCGACCGAGGGGGGTCGGCGATGGCGTGTCGATATATATAACAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO11119
Plant Latin Name: Salta Triflora
Taxonomy Genus: Salta
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 249117
Plant-of-the-World-Online: 77116653-1

Used in Medicines

Unknown.

Geographical Distribution

Brazil; Bolivia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

84 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


51 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99962

Ingredient ID: NPC95567

Ingredient ID: NPC86935

Ingredient ID: NPC8509

Ingredient ID: NPC83818

Ingredient ID: NPC76336

Ingredient ID: NPC7633

Ingredient ID: NPC76114

Ingredient ID: NPC71559

Ingredient ID: NPC71281

Ingredient ID: NPC70093

Ingredient ID: NPC68625

Ingredient ID: NPC66815

Ingredient ID: NPC638

Ingredient ID: NPC60546

Ingredient ID: NPC52400

Ingredient ID: NPC50185

Ingredient ID: NPC48003

Ingredient ID: NPC46410

Ingredient ID: NPC44440

Ingredient ID: NPC41874

Ingredient ID: NPC34770

Ingredient ID: NPC33320

Ingredient ID: NPC305016

Ingredient ID: NPC304309

Ingredient ID: NPC301353

Ingredient ID: NPC298933

Ingredient ID: NPC298064

Ingredient ID: NPC291218

Ingredient ID: NPC286060

Ingredient ID: NPC285408

Ingredient ID: NPC28462

Ingredient ID: NPC280983

Ingredient ID: NPC278951

Ingredient ID: NPC27677

Ingredient ID: NPC273756

Ingredient ID: NPC269367

Ingredient ID: NPC265082

Ingredient ID: NPC263265

Ingredient ID: NPC253102

Ingredient ID: NPC2457

Ingredient ID: NPC244943

Ingredient ID: NPC238874

Ingredient ID: NPC237174

Ingredient ID: NPC234431

Ingredient ID: NPC23161

Ingredient ID: NPC230301

Ingredient ID: NPC230085

Ingredient ID: NPC224494

Ingredient ID: NPC221758

Ingredient ID: NPC2098

Ingredient ID: NPC20791

Ingredient ID: NPC207857

Ingredient ID: NPC205924

Ingredient ID: NPC186908

Ingredient ID: NPC186626

Ingredient ID: NPC186530

Ingredient ID: NPC18618

Ingredient ID: NPC180483

Ingredient ID: NPC179950

Ingredient ID: NPC177431

Ingredient ID: NPC176740

Ingredient ID: NPC173923

Ingredient ID: NPC169889

Ingredient ID: NPC164917

Ingredient ID: NPC160100

Ingredient ID: NPC158955

Ingredient ID: NPC154268

Ingredient ID: NPC151548

Ingredient ID: NPC14782

Ingredient ID: NPC141513

Ingredient ID: NPC138805

Ingredient ID: NPC136545

Ingredient ID: NPC131885

Ingredient ID: NPC12869

Ingredient ID: NPC128668

Ingredient ID: NPC126723

Ingredient ID: NPC123731

Ingredient ID: NPC117986

Ingredient ID: NPC115362

Ingredient ID: NPC113740

Ingredient ID: NPC113050

Ingredient ID: NPC112731

Ingredient ID: NPC101858