• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lepidium Apetalum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TACCTGTCCAAAACAGAACGACCCGCGAACAAACTATCATCACTTGCGGTGGGCCGGTTTCTTAGCAGATCCCGTGTCCACCGAATCCTTGGTTTCGCGTGCCCTTCCGAACGGGCGGTCGTGCGCGTAGCCGATGGATATCACAACAACACGGCACGAAAAGTGTCAAGGAACATGCAACCGAACGGCCAGCGTTCGCCTTCCCGGAGACGGTGCAAGCGCGAATGCTGTGCTGCGATCAAAAGTCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACAAATCGTCGTCCCCCTCACAAAATATTGCGAGTGTGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGACCAAAATCTGAGCTGAGGATGCTGGGAGCGTCCCGACATGCGGTGGTGATCTAAAGCCTCTTCATATTGCCGGTCGCTCCTCTCCGTAAGCTCTCGTTGACCCAATGTCCTCAAAGCGACC

Click for details-----ITS1

TACCTGTCCAAAACAGAACGACCCGCGAACAAACTATCATCACTTGCGGTGGGCCGGTTTCTTAGCAGATCCCGTGTCCACCTAATCCTTGGTTTCGCGTTTCCTTCCGAACGGGAGATCTCTCCCGGACCGGTCGTGCGCGTAGCCGATGGATATCACAACAACACGGCACGAAAAGTGTCAAGGAACATGCAACCGAACGGCCAGCGTTCGCCTTCCCGGAGACGGTGCAAGCGCGAATGCTGTGCTGCGATCAAAAGTCTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO11097
Plant Latin Name: Lepidium Apetalum
Taxonomy Genus: Lepidium
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 153459
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India; China

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antiasthmatic; Antibacterial; Antitussive; Cardiotonic; Diuretic; Expectorant; Purgative

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

87 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

35 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97160

Ingredient ID: NPC94631

Ingredient ID: NPC93361

Ingredient ID: NPC91369

Ingredient ID: NPC84192

Ingredient ID: NPC78766

Ingredient ID: NPC74304

Ingredient ID: NPC72886

Ingredient ID: NPC71204

Ingredient ID: NPC63186

Ingredient ID: NPC59436

Ingredient ID: NPC57896

Ingredient ID: NPC56592

Ingredient ID: NPC52955

Ingredient ID: NPC47680

Ingredient ID: NPC46757

Ingredient ID: NPC46095

Ingredient ID: NPC37647

Ingredient ID: NPC35109

Ingredient ID: NPC34963

Ingredient ID: NPC34103

Ingredient ID: NPC310686

Ingredient ID: NPC310373

Ingredient ID: NPC308043

Ingredient ID: NPC306142

Ingredient ID: NPC300593

Ingredient ID: NPC300326

Ingredient ID: NPC299134

Ingredient ID: NPC296910

Ingredient ID: NPC294548

Ingredient ID: NPC292356

Ingredient ID: NPC290020

Ingredient ID: NPC279992

Ingredient ID: NPC276625

Ingredient ID: NPC272535

Ingredient ID: NPC263046

Ingredient ID: NPC256175

Ingredient ID: NPC243728

Ingredient ID: NPC241935

Ingredient ID: NPC232344

Ingredient ID: NPC229217

Ingredient ID: NPC22678

Ingredient ID: NPC226572

Ingredient ID: NPC221281

Ingredient ID: NPC220757

Ingredient ID: NPC216630

Ingredient ID: NPC213697

Ingredient ID: NPC209970

Ingredient ID: NPC20791

Ingredient ID: NPC202116

Ingredient ID: NPC201147

Ingredient ID: NPC200282

Ingredient ID: NPC200039

Ingredient ID: NPC18905

Ingredient ID: NPC184399

Ingredient ID: NPC1813

Ingredient ID: NPC180032

Ingredient ID: NPC179950

Ingredient ID: NPC17938

Ingredient ID: NPC178049

Ingredient ID: NPC175791

Ingredient ID: NPC16920

Ingredient ID: NPC165159

Ingredient ID: NPC156482

Ingredient ID: NPC153572

Ingredient ID: NPC152707

Ingredient ID: NPC144062

Ingredient ID: NPC141765

Ingredient ID: NPC141414

Ingredient ID: NPC137585

Ingredient ID: NPC135194

Ingredient ID: NPC134902

Ingredient ID: NPC131382

Ingredient ID: NPC125062

Ingredient ID: NPC125037

Ingredient ID: NPC124277

Ingredient ID: NPC124261

Ingredient ID: NPC119621

Ingredient ID: NPC119090

Ingredient ID: NPC108970

Ingredient ID: NPC10709

Ingredient ID: NPC106446

Ingredient ID: NPC10636

Ingredient ID: NPC103887

Ingredient ID: NPC103438

Ingredient ID: NPC10180

Ingredient ID: NPC100347