CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Paederia Scandens

Example Image

PLANiTS DNA barcode

ATCTCGTCGCCACCCCCTCCCTCTCCCCTCGCGGGACGCGGACGGGGGCGGCGGAGGATGGCCCCCCGTGCCACTCGGCGCGGCCGGCCCAAACGAGAGTCCCCGGCGCAGGACGCCGCGACGATGTGGTGGTTGAACTCCTCAGCACGATCGACGTCGCGGCCCGGCCCGGCGGAACAATGTAGACCCCGAGGCCTCCCCTCCCGGAAGGGAGGGAGGCCCCTCGAAC

Taxonomic Information

Plant ID: NPO11045
Plant Latin Name: Paederia Scandens
Taxonomy Genus: Paederia
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 284589
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Philippines; Indonesia; India; United States; Vietnam; China; Thailand

Traditional Medicine System:

Indian Folk; TCM

Medicinal Functions:

Carminative; Depurative; Vermifuge

Geographical Distribution

Philippines; Indonesia; India; United States; Vietnam; China; Thailand

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

55 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

39 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)