• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Moringa Oleifera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TATGTTTGTTGAAGCGAGTACTGCGGAGACATTGTCGAACTCGCTCAGCGAACGACCCGCGACACGTTGTAAACACACTGGCGGGGCGGAGGGCTCTCGAGCCCCTCGTCCCGCCTCGCGCGGCAAGGGTGCGCGGGCTCGCGCCCAAGCCCCTCGTCGCGCGCAACAACAAAACCCACAGCGCGGGATGCGCCAAGGAACTCGAATGAAAAAGCACGCCCCAGTCGCCCCGATCTCGGTGCGCGGCTGGCGGTCGTGTCGTCCCTAAACGATGTCTAAAATGACTCTCGACAATGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAAAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGGTGTCAAGCACCGTCGCCCCCGACCCCCCCGCATCCCTTCGGGGAGGGAAGGGACCATCGCGGGGCGAATGTTGGCCTCCCGTGCGCCTTTGGCTCGCGGTTGGCCTAAAAAAAAAGCCTCAAGCGACGCCGCGTCACGGCTTGGCGGTGGGTAAAAAAAAGCCCTCGTGCTCCCTCGTGCGCGCGTCGCCTCGCTCGCGGCTCACGAACCCAATGAATCGATCGATCGAAGAATGCGACCCCCAAGGTCAGGAGGAACCCCCATTGATATTTAAGCTATATTCAATAAGCGGAAGAAA

Click for details-----ITS1

TGGGTAGTAAAAATTCGTAGCAAGGGTTTTTTCTATGGTGAAGCGTTCTGTGAGGGTGCCTTTTTTGAAAACTATGCTCAGTCTAAAGTGACCCTCGCACGCGTGCTATACACACTCGCTGGGGTGGGGGGGCTCTCGAGCCCTTCGCTTCTTCCTCCCTTGGTAAGGGTGGGGGGGGCTTGCTCTCAAACACTCTCGTTGCTCGCAACAACAAAACCCACAGCGCGGGATGCGCCAAGGAAATAGAATGAAAAAGCACGCCCCAGTCGCCCCGATCTCGGTGCGCGGCTGGCGGTCGTGTCGTCCCTAAACGATGTCTAAAA

Click for details-----ITS2

ACCGTCGCCCCCGACCCCCCCGCATCCCTTCGGGGAGGGAAGGGACCATCGCGGGGCGAATGTTGGCCTCCCGTGCGCCTTTGGCTCGCGGTTGGCCTAAAAAAAAAGCCTCAAGCGACGCCGCGTCACGGCTTGGCGGTGGGTAAAAAAAAGCCCTCGTGCTCCCTCGTGCGCGCGTCGCCTCGCTCGCGGCTCACGAACCCAATGAATCGATCGATCGAAGAATGCGACCCCCAAGGTCAGGAGGAACCCCCATTGATATTTAAGCTATATTCAATAAGCGGAAGAAA
Taxonomic Information

Plant ID: NPO11021
Plant Latin Name: Moringa Oleifera
Taxonomy Genus: Moringa
Taxonomy Family: Moringaceae

Plant External Links:

NCBI TaxonomyDB: 3735
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Ghana; Pakistan; Saudi Arabia; Malaysia; Philippines; Indonesia; India; United States; Togo; Senegal; Thailand; Nigeria; Burkina Faso

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Ayurveda; Siddha

Geographical Distribution

Ghana; Pakistan; Saudi Arabia; Togo; Philippines; Indonesia; India; United States; Malaysia; Senegal; Thailand; Nigeria; Burkina Faso

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

169 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


125 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

95 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97282

Ingredient ID: NPC97004

Ingredient ID: NPC94721

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92369

Ingredient ID: NPC88566

Ingredient ID: NPC86418

Ingredient ID: NPC83535

Ingredient ID: NPC79056

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC70744

Ingredient ID: NPC67650

Ingredient ID: NPC66225

Ingredient ID: NPC62086

Ingredient ID: NPC62045

Ingredient ID: NPC60548

Ingredient ID: NPC5599

Ingredient ID: NPC55412

Ingredient ID: NPC54366

Ingredient ID: NPC53773

Ingredient ID: NPC51700

Ingredient ID: NPC50266

Ingredient ID: NPC489907

Ingredient ID: NPC484100

Ingredient ID: NPC484099

Ingredient ID: NPC484098

Ingredient ID: NPC46801

Ingredient ID: NPC45782

Ingredient ID: NPC37250

Ingredient ID: NPC37009

Ingredient ID: NPC3649

Ingredient ID: NPC36434

Ingredient ID: NPC36047

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313179

Ingredient ID: NPC311057

Ingredient ID: NPC307783

Ingredient ID: NPC30749

Ingredient ID: NPC299529

Ingredient ID: NPC29883

Ingredient ID: NPC298821

Ingredient ID: NPC295275

Ingredient ID: NPC294887

Ingredient ID: NPC289316

Ingredient ID: NPC288807

Ingredient ID: NPC287660

Ingredient ID: NPC284967

Ingredient ID: NPC283804

Ingredient ID: NPC283746

Ingredient ID: NPC281686

Ingredient ID: NPC2803

Ingredient ID: NPC27657

Ingredient ID: NPC273756

Ingredient ID: NPC272753

Ingredient ID: NPC272614

Ingredient ID: NPC272400

Ingredient ID: NPC27184

Ingredient ID: NPC271270

Ingredient ID: NPC270043

Ingredient ID: NPC269919

Ingredient ID: NPC264811

Ingredient ID: NPC264317

Ingredient ID: NPC262789

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC257587

Ingredient ID: NPC255042

Ingredient ID: NPC248869

Ingredient ID: NPC248867

Ingredient ID: NPC248799

Ingredient ID: NPC244229

Ingredient ID: NPC243728

Ingredient ID: NPC240756

Ingredient ID: NPC239039

Ingredient ID: NPC237875

Ingredient ID: NPC237812

Ingredient ID: NPC235279

Ingredient ID: NPC235262

Ingredient ID: NPC233681

Ingredient ID: NPC233657

Ingredient ID: NPC232375

Ingredient ID: NPC230305

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC226453

Ingredient ID: NPC22098

Ingredient ID: NPC219913

Ingredient ID: NPC217612

Ingredient ID: NPC217439

Ingredient ID: NPC215894

Ingredient ID: NPC215412

Ingredient ID: NPC214973

Ingredient ID: NPC214909

Ingredient ID: NPC213749

Ingredient ID: NPC213370

Ingredient ID: NPC211756

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC206161

Ingredient ID: NPC203468

Ingredient ID: NPC199652

Ingredient ID: NPC199116

Ingredient ID: NPC198798

Ingredient ID: NPC190771

Ingredient ID: NPC188238

Ingredient ID: NPC187937

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC185414

Ingredient ID: NPC18351

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC179950

Ingredient ID: NPC179587

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC173381

Ingredient ID: NPC171928

Ingredient ID: NPC171736

Ingredient ID: NPC170035

Ingredient ID: NPC169749

Ingredient ID: NPC169456

Ingredient ID: NPC167400

Ingredient ID: NPC164905

Ingredient ID: NPC164512

Ingredient ID: NPC163248

Ingredient ID: NPC161155

Ingredient ID: NPC159418

Ingredient ID: NPC1591

Ingredient ID: NPC156461

Ingredient ID: NPC154176

Ingredient ID: NPC152451

Ingredient ID: NPC152384

Ingredient ID: NPC150950

Ingredient ID: NPC15049

Ingredient ID: NPC150323

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC147216

Ingredient ID: NPC145935

Ingredient ID: NPC139546

Ingredient ID: NPC139320

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC137894

Ingredient ID: NPC136951

Ingredient ID: NPC136014

Ingredient ID: NPC134612

Ingredient ID: NPC133671

Ingredient ID: NPC131310

Ingredient ID: NPC131192

Ingredient ID: NPC131122

Ingredient ID: NPC130854

Ingredient ID: NPC13007

Ingredient ID: NPC126681

Ingredient ID: NPC123761

Ingredient ID: NPC120926

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC114239

Ingredient ID: NPC112890

Ingredient ID: NPC108339

Ingredient ID: NPC105559

Ingredient ID: NPC104405

Ingredient ID: NPC10211

Ingredient ID: NPC100879