• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Epimedium Sagittatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAACCTGCGGAAGGATCATTGTCAAAACCTGCAAAGCAGAACGACCAGCGAACTTGTGAAAAACACTTATGGGAGGGACGAAGGGTGTTAACCTTGAATCCTTCCTATTGGGTCACTTGGGACGATTGTGTCGTGAAAGCGACAACGACGTCCCTCGTTGATTCAAATAACAACTCGGCGCGGTCTGCGCCAAGGAAAATCTTAACGGATAGAGCACGTCTTTATGACGATGTTGTAATTCCGATCTTATAACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACGCACAGCGTCGCTCCCACCATGATGCCTTTGTTTTGTTATCGGGCAACTGCAACGTGGCTTGGGAAGCGGATATTGGCCCCCCGTACCTTTGTAGGCGCGGCCGGCCTAAAATTCGGCCCTCGGCGACGAGCGTCACGATCAGTGGTGGTTGAATAACCCCTTTGTCATAGACCGGTATCGTGTTGTTTCGTCGTCTATTTGGGCCATATGGACCCTTGCGTGTCGTGTAAACGACATTCACT

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO10969
Plant Latin Name: Epimedium Sagittatum
Taxonomy Genus: Epimedium
Taxonomy Family: Berberidaceae

Plant External Links:

NCBI TaxonomyDB: 253616
Plant-of-the-World-Online: 107314-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antirheumatic; Aphrodisiac; Carminative; Expectorant; Infertility; Kidney; Ophthalmic; Tonic; Vasodilator

Geographical Distribution

Japan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

163 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


99 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

66 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98745

Ingredient ID: NPC98356

Ingredient ID: NPC97804

Ingredient ID: NPC96152

Ingredient ID: NPC9611

Ingredient ID: NPC94399

Ingredient ID: NPC93500

Ingredient ID: NPC92844

Ingredient ID: NPC9117

Ingredient ID: NPC88789

Ingredient ID: NPC87397

Ingredient ID: NPC8659

Ingredient ID: NPC86054

Ingredient ID: NPC85813

Ingredient ID: NPC85346

Ingredient ID: NPC8396

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC76648

Ingredient ID: NPC75425

Ingredient ID: NPC74604

Ingredient ID: NPC74304

Ingredient ID: NPC7365

Ingredient ID: NPC72722

Ingredient ID: NPC71786

Ingredient ID: NPC71536

Ingredient ID: NPC71347

Ingredient ID: NPC70759

Ingredient ID: NPC67308

Ingredient ID: NPC67020

Ingredient ID: NPC66087

Ingredient ID: NPC65786

Ingredient ID: NPC62765

Ingredient ID: NPC62254

Ingredient ID: NPC61477

Ingredient ID: NPC60

Ingredient ID: NPC5319

Ingredient ID: NPC5173

Ingredient ID: NPC50898

Ingredient ID: NPC4920

Ingredient ID: NPC47724

Ingredient ID: NPC40233

Ingredient ID: NPC3936

Ingredient ID: NPC39

Ingredient ID: NPC34103

Ingredient ID: NPC320283

Ingredient ID: NPC319463

Ingredient ID: NPC318533

Ingredient ID: NPC317489

Ingredient ID: NPC31428

Ingredient ID: NPC311256

Ingredient ID: NPC311000

Ingredient ID: NPC31092

Ingredient ID: NPC308718

Ingredient ID: NPC306590

Ingredient ID: NPC306207

Ingredient ID: NPC305987

Ingredient ID: NPC304870

Ingredient ID: NPC303430

Ingredient ID: NPC302857

Ingredient ID: NPC302293

Ingredient ID: NPC299856

Ingredient ID: NPC299804

Ingredient ID: NPC29883

Ingredient ID: NPC298049

Ingredient ID: NPC294902

Ingredient ID: NPC29183

Ingredient ID: NPC291704

Ingredient ID: NPC290926

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288298

Ingredient ID: NPC286788

Ingredient ID: NPC282086

Ingredient ID: NPC281131

Ingredient ID: NPC279980

Ingredient ID: NPC279696

Ingredient ID: NPC279121

Ingredient ID: NPC278419

Ingredient ID: NPC278068

Ingredient ID: NPC273699

Ingredient ID: NPC273538

Ingredient ID: NPC269171

Ingredient ID: NPC268312

Ingredient ID: NPC26782

Ingredient ID: NPC264779

Ingredient ID: NPC26417

Ingredient ID: NPC258552

Ingredient ID: NPC25675

Ingredient ID: NPC253729

Ingredient ID: NPC253487

Ingredient ID: NPC252558

Ingredient ID: NPC250543

Ingredient ID: NPC249714

Ingredient ID: NPC242149

Ingredient ID: NPC240735

Ingredient ID: NPC239687

Ingredient ID: NPC238010

Ingredient ID: NPC237460

Ingredient ID: NPC236709

Ingredient ID: NPC234560

Ingredient ID: NPC230301

Ingredient ID: NPC226676

Ingredient ID: NPC225710

Ingredient ID: NPC224731

Ingredient ID: NPC224714

Ingredient ID: NPC219913

Ingredient ID: NPC219876

Ingredient ID: NPC219053

Ingredient ID: NPC216489

Ingredient ID: NPC212625

Ingredient ID: NPC211773

Ingredient ID: NPC20791

Ingredient ID: NPC200528

Ingredient ID: NPC199191

Ingredient ID: NPC198251

Ingredient ID: NPC197606

Ingredient ID: NPC193375

Ingredient ID: NPC184049

Ingredient ID: NPC180968

Ingredient ID: NPC179950

Ingredient ID: NPC179198

Ingredient ID: NPC179169

Ingredient ID: NPC176740

Ingredient ID: NPC175819

Ingredient ID: NPC174249

Ingredient ID: NPC173265

Ingredient ID: NPC172653

Ingredient ID: NPC170526

Ingredient ID: NPC167976

Ingredient ID: NPC165159

Ingredient ID: NPC163294

Ingredient ID: NPC15658

Ingredient ID: NPC155025

Ingredient ID: NPC153572

Ingredient ID: NPC151923

Ingredient ID: NPC145858

Ingredient ID: NPC145038

Ingredient ID: NPC144764

Ingredient ID: NPC142931

Ingredient ID: NPC142703

Ingredient ID: NPC141768

Ingredient ID: NPC141765

Ingredient ID: NPC139548

Ingredient ID: NPC135088

Ingredient ID: NPC131745

Ingredient ID: NPC129841

Ingredient ID: NPC121497

Ingredient ID: NPC120926

Ingredient ID: NPC12053

Ingredient ID: NPC120464

Ingredient ID: NPC119307

Ingredient ID: NPC116775

Ingredient ID: NPC114979

Ingredient ID: NPC113212

Ingredient ID: NPC111929

Ingredient ID: NPC111888

Ingredient ID: NPC109813

Ingredient ID: NPC108960

Ingredient ID: NPC1075

Ingredient ID: NPC107451

Ingredient ID: NPC104387

Ingredient ID: NPC103264