• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Peganum Harmala


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCGCAGCAGAACGACCCGCGAACACGTCACAACTCCGGGGGGACGGCCCGCCGTTCCCCCCGCCGTGGCGCGGACGGGAGGCGTCGCGCTCGCGCGCGCCCCTCCGTCCCGCGCCTCGGACCCACGAACCCCGGCGCAACGCGCGCCAAGGAAACTCAAACGAGAGAGCCGGTCGGCCTCGCCCCGGACACGGTGCGGCGTCGGCCGTGCCTCCTTTCGATACGCAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATTGAAACCTCCTGCCAATTTCCTTTTGATAGGTATTGTGCAGGGTGGACGTTGGCCTCCCGTGAGCTCTTTTGTCTCATGGTTGGTTGAAAATTGAGACCTTGGTAGGGTGTGCCTTGATAAATGGTGGTTGTGTGACCCACGAGACCAATCATGCGCTGCTCTATTTGATTTGGCCTCCTTTACCCATATGCGTTTCTAAACGCTCGTG

Click for details-----ITS1

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCGCAGCAGAACGACCCGCGAACACGTCACAACTCCGGGGGGACGGCCCGCCGTTCCCCCCGCCGTGGCGCGGACGGGAGGCGTCGCGCTCGCGCGCGCCCCTCCGTCCCGCGCCTCGGACCCACGAACCCCGGCGCAACGCGCGCCAAGGAAACTCAAACGAGAGAGCCGGTCGGCCTCGCCCCGGACACGGTGCGGCGTCGGCCGTGCCTCCTTTCGATACGCAACAA

Click for details-----ITS2

ATCGTCGCCCCCCCGCCGCTCCCYGCGCCCCTCTCCGGGGGACGGGTCGCGSGSGGGTGGGCGGAGATTGSCCTCCCGCRAGTCMCCCCTCGYGGCTGGCCKAAATACSGATCCCCGGCCRGCGGTGGCCGCGACGTTSGGTGGTCGTAACGCGCCTCGTGAACCCGTCGCGCGCYCCGCTTCKCCTCTSGCGGGATCCCCGGCCCCGAGGCGGCGCARGCCGCTCGCA
Taxonomic Information

Plant ID: NPO1085
Plant Latin Name: Peganum Harmala
Taxonomy Genus: Peganum
Taxonomy Family: Nitrariaceae

Plant External Links:

NCBI TaxonomyDB: 43879
Plant-of-the-World-Online: 774545-1

Used in Medicines

Country/Region:
Turkmenistan; Algeria; India; Lebanon; Jordan; China; Iraq

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Abortifacient; Alterative; Aphrodisiac; Digestive; Diuretic; Emmenagogue; Galactogogue; Hallucinogenic; Miscellany; Narcotic; Ophthalmic; Parasiticide; Uterine tonic; Vermifuge

Geographical Distribution

Turkey; Italy; Bangladesh; India; France; Turkmenistan; Saudi Arabia; Algeria; Jordan; China; Iraq; Spain; Ukraine; Libya; United States; Morocco; Russia; Bulgaria; Pakistan; Romania; South Africa; Egypt; Lebanon; Tunisia; Greece; Hungary

Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

54 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


49 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

38 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC96835

Ingredient ID: NPC84478

Ingredient ID: NPC81931

Ingredient ID: NPC72980

Ingredient ID: NPC6374

Ingredient ID: NPC50662

Ingredient ID: NPC479097

Ingredient ID: NPC479096

Ingredient ID: NPC479095

Ingredient ID: NPC479094

Ingredient ID: NPC479093

Ingredient ID: NPC479092

Ingredient ID: NPC479091

Ingredient ID: NPC479090

Ingredient ID: NPC479089

Ingredient ID: NPC479088

Ingredient ID: NPC479087

Ingredient ID: NPC479086

Ingredient ID: NPC479085

Ingredient ID: NPC471762

Ingredient ID: NPC37739

Ingredient ID: NPC36926

Ingredient ID: NPC328683

Ingredient ID: NPC327662

Ingredient ID: NPC324445

Ingredient ID: NPC321618

Ingredient ID: NPC306813

Ingredient ID: NPC291389

Ingredient ID: NPC283130

Ingredient ID: NPC275175

Ingredient ID: NPC260434

Ingredient ID: NPC251544

Ingredient ID: NPC245222

Ingredient ID: NPC232727

Ingredient ID: NPC231288

Ingredient ID: NPC226662

Ingredient ID: NPC20791

Ingredient ID: NPC207428

Ingredient ID: NPC181323

Ingredient ID: NPC179787

Ingredient ID: NPC175899

Ingredient ID: NPC169101

Ingredient ID: NPC166829

Ingredient ID: NPC164802

Ingredient ID: NPC160125

Ingredient ID: NPC154197

Ingredient ID: NPC146472

Ingredient ID: NPC142606

Ingredient ID: NPC127394

Ingredient ID: NPC122436

Ingredient ID: NPC116775

Ingredient ID: NPC107975

Ingredient ID: NPC104788

Ingredient ID: NPC103197

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Therapeutic Target Enzyme ALOX12 Arachidonate 12-lipoxygenase P18054 CHEMBL3687
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Enzyme POLB DNA polymerase beta P06746 CHEMBL2392
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Other cytosolic protein MAPT Microtubule-associated protein tau P10636 CHEMBL1293224
Therapeutic Target Oxidoreductase MAOA Monoamine oxidase A P21397 CHEMBL1951
Showing 1 to 10 of 31 entries
Previous1234Next
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level21
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
NCT00455416 Dietary Intervention in Follicular Lymphoma follicular lymphoma Quercetin (NPC20791) NP level
NCT01348204 Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators cystic fibrosis Quercetin (NPC20791) NP level
NCT01375101 Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus oral lichen planus Quercetin (NPC20791) NP level
NCT01438320 Q-Trial in Patients With Hepatitis C chronic hepatitis C virus infection Quercetin (NPC20791) NP level
NCT01708278 Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD) chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT01720147 Quercetin in Children With Fanconi Anemia; a Pilot Study Fanconi anemia Quercetin (NPC20791) NP level
NCT01839344 Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes. type 2 diabetes mellitus Quercetin (NPC20791) NP level
NCT01912820 Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery prostate adenocarcinoma Quercetin (NPC20791) NP level
NCT02226484 Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD? gastroesophageal reflux disease Quercetin (NPC20791) NP level
NCT02848131 Senescence in Chronic Kidney Disease chronic kidney disease Quercetin (NPC20791) NP level
Showing 1 to 10 of 21 entries
Previous123Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Acquired hypermelanosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60
 TYR
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 TYR,MAOA
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AURKB,KDR,DPP4
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 AXL,PIM1,AURKB,SRC,TP53,CDK9,FLT3,MAPT
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 AURKB,CA7,CA12,TSHR,NPSR1,CDK1,CYP2C9,XDH
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CA7,CISD1,POLB,DPP4,XDH,HSD17B2,RECQL,AURKB,CYP1B1,CYP2C9,MET,DYRK2,ALOX15,PIM1,ABCG2,AXL,NPSR1,ALOX5,LMNA
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,ALOX15
 NCT01912820
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 AURKB,NOX4,MET,NPSR1,CDK1,CYP19A1,ALOX15
Ageing associated decline in intrinsic capacity
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG2A
 NCT04946383,NCT05422885
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 MAOA,ADRA2C,FLT3,MAPT,MET,KDR
Showing 1 to 10 of 206 entries
Previous12345…21Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group