CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Protea Compacta

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTGCCCAGCAGACAGACCCGCGAACACGTCTAACGGTGACCGGGGGGCGAGGGGCGATGTAACAAACAATTGGGCGGTCGGCGCCAAGGAACTCACAACGGAACCGGCGTGCCGCCGTTGGGCCCTTGGCCCGGCGCGTGCCGCCAAGAATCCGAATCTCACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAGGCCATCGGGCCGAGGGCACGTCTGCCTGGGCGTCACGCGTAAGTTGCCCGCCCCCCGCCGTCCCCGTGGCGGCGGAGCGCGGAGCGGAGATTGGCCCCCCATGCTCCTTTCGGGGCGTGGCCGGCCCAAAGAGAAGGCCCCCAGTGCGGCGAGCGCCGCGACGAGTGGTGGACGAAGCTCATTCGCCATGGCTCGGACGTCGTGGGCGCCTCGCCTCCGTGGGCCCCTTGGAACCCCCTGTGTGCGTCGCGGTCCTCACCGACCGACGATGCTCCGA

Click for details-----ITS1

TCGATGCCTGCCCAGCAGACAGACCCGCGAACACGTCTAACGGTGACCGGGGGGCGAGGGGCGATGTAACAAACAATTGGGCGGTCGGCGCCAAGGAACTCACAACGGAACCGGCGTGCCGCCGTTGGGCCCTTGGCCCGGCGCGTGCCGCCAAGAATCCGAATCTCACGAA

Click for details-----ITS2

GTAAGTTGCCCGCCCCCCGCCGTCCCCGTGGCGGCGGAGCGCGGAGCGGAGATTGGCCCCCCATGCTCCTTTCGGGGCGTGGCCGGCCCAAAGAGAAGGCCCCCAGTGCGGCGAGCGCCGCGACGAGTGGTGGACGAAGCTCATTCGCCATGGCTCGGACGTCGTGGGCGCCTCGCCTCCGTGGGCCCCTTGGAACCCCCTGTGTGCGTCGCGGTCCTCACCGACCGACGATGCTCCGA

Taxonomic Information

Plant ID: NPO10834
Plant Latin Name: Protea Compacta
Taxonomy Genus: Protea
Taxonomy Family: Proteaceae

Plant External Links:

NCBI TaxonomyDB: 273580
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

93 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC91411

Ingredient ID: NPC87590

Ingredient ID: NPC86906

Ingredient ID: NPC82989

Ingredient ID: NPC82329

Ingredient ID: NPC80436

Ingredient ID: NPC74856

Ingredient ID: NPC7214

Ingredient ID: NPC69144

Ingredient ID: NPC67816

Ingredient ID: NPC64246

Ingredient ID: NPC60657

Ingredient ID: NPC60372

Ingredient ID: NPC58208

Ingredient ID: NPC49653

Ingredient ID: NPC49070

Ingredient ID: NPC48660

Ingredient ID: NPC46915

Ingredient ID: NPC45267

Ingredient ID: NPC4230

Ingredient ID: NPC40174

Ingredient ID: NPC36266

Ingredient ID: NPC354

Ingredient ID: NPC34884

Ingredient ID: NPC32905

Ingredient ID: NPC306581

Ingredient ID: NPC306286

Ingredient ID: NPC305201

Ingredient ID: NPC300241

Ingredient ID: NPC293776

Ingredient ID: NPC284838

Ingredient ID: NPC283277

Ingredient ID: NPC280090

Ingredient ID: NPC279514

Ingredient ID: NPC271648

Ingredient ID: NPC262372

Ingredient ID: NPC26181

Ingredient ID: NPC26176

Ingredient ID: NPC258693

Ingredient ID: NPC248058

Ingredient ID: NPC24733

Ingredient ID: NPC244582

Ingredient ID: NPC243935

Ingredient ID: NPC239126

Ingredient ID: NPC233256

Ingredient ID: NPC229215

Ingredient ID: NPC22771

Ingredient ID: NPC226850

Ingredient ID: NPC220949

Ingredient ID: NPC219768

Ingredient ID: NPC217788

Ingredient ID: NPC217129

Ingredient ID: NPC216693

Ingredient ID: NPC213631

Ingredient ID: NPC208580

Ingredient ID: NPC200794

Ingredient ID: NPC197292

Ingredient ID: NPC196134

Ingredient ID: NPC195456

Ingredient ID: NPC18509

Ingredient ID: NPC182962

Ingredient ID: NPC178831

Ingredient ID: NPC169375

Ingredient ID: NPC168551

Ingredient ID: NPC164973

Ingredient ID: NPC163329

Ingredient ID: NPC158755

Ingredient ID: NPC158162

Ingredient ID: NPC158032

Ingredient ID: NPC154397

Ingredient ID: NPC152829

Ingredient ID: NPC152039

Ingredient ID: NPC149281

Ingredient ID: NPC148164

Ingredient ID: NPC145773

Ingredient ID: NPC14522

Ingredient ID: NPC140419

Ingredient ID: NPC134847

Ingredient ID: NPC127780

Ingredient ID: NPC12578

Ingredient ID: NPC121855

Ingredient ID: NPC120458

Ingredient ID: NPC118329

Ingredient ID: NPC116350

Ingredient ID: NPC116123

Ingredient ID: NPC115311

Ingredient ID: NPC113405

Ingredient ID: NPC109268

Ingredient ID: NPC105504

Ingredient ID: NPC1041

Ingredient ID: NPC103593

Ingredient ID: NPC102622

Ingredient ID: NPC101042

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232
Therapeutic Target	Nuclear hormone receptor subfamily 3	NR3C1	Glucocorticoid receptor	P04150	CHEMBL2034
Therapeutic Target	Secreted protein	SERPINA6	Corticosteroid binding globulin	P08185	CHEMBL2421
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA2A	Alpha-2a adrenergic receptor	P08913	CHEMBL1867
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA2C	Alpha-2c adrenergic receptor	P18825	CHEMBL1916
Therapeutic Target	Small molecule receptor (family A GPCR)	HRH3	Histamine H3 receptor	Q9Y5N1	CHEMBL264
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	154

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00392834	Rituximab and Combination Chemotherapy in Treating Patients With Newly Diagnosed, HIV-Associated Burkitt's Lymphoma	lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00873093	Bortezomib and Combination Chemotherapy in Treating Young Patients With Relapsed Acute Lymphoblastic Leukemia or Lymphoblastic Lymphoma	B-cell acute lymphoblastic leukemia;lymphoblastic lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00676585	Corticosteroid Therapy in Refractory Shock Following Cardiac Arrest	cardiac arrest	Hydrocortisone (NPC18509)	NP level
NCT01014364	Low Doses Corticosteroids as Adjuvant Therapy for the Treatment of Severe H1N1 Flu	influenza;viral pneumonia	Hydrocortisone (NPC18509)	NP level
NCT02535806	Four Drug Reinduction With Bortezomib for Relapsed or Refractory ALL or LL in Children and Young Adults	acute lymphoblastic leukemia;lymphoblastic lymphoma	Hydrocortisone (NPC18509)	NP level
NCT02256865	Hormonal Mechanisms of Sleep Restriction	insulin resistance	Hydrocortisone (NPC18509)	NP level
NCT00354107	Ifosfamide, Carboplatin, Etoposide, and SGN-30 in Treating Young Patients With Recurrent Anaplastic Large Cell Lymphoma	anaplastic large cell lymphoma	Hydrocortisone (NPC18509)	NP level
NCT02425852	A Randomized, Multicenter Open Label Study Comparing Early Administration of Azathioprine Plus IFX to Steroids Plus Azathioprine for Acute Severe Colitis	ulcerative colitis	Hydrocortisone (NPC18509)	NP level
NCT04898894	Study of Selinexor and Venetoclax in Combination With Chemotherapy in Pediatric and Young Adult Patients With Refractory or Relapsed Acute Myeloid Leukemia	acute leukemia of ambiguous lineage	Hydrocortisone (NPC18509)	NP level
NCT00953576	Ketoconazole, Hydrocortisone, Dutasteride and Lapatinib (KHAD-L) in Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT02043587	Chemotherapy With Liposomal Cytarabine CNS Prophylaxis for Adult Acute Lymphoblastic Leukemia & Lymphoblastic Lymphoma	acute lymphoblastic leukemia;lymphoblastic lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00899847	Phase 2 Study of Autologous Followed by Nonmyeloablative Allogeneic Transplantation Using TLI & ATG	multiple myeloma	Hydrocortisone (NPC18509)	NP level
NCT01718964	Acute Effects of Cortisol on Heroin Craving in Opioid Dependence (Ghost-Basel)	opioid dependence	Hydrocortisone (NPC18509)	NP level
NCT02465606	A Study to Evaluate the Safety of Lebrikizumab Compared to Topical Corticosteroids in Adult Patients With Atopic Dermatitis	atopic eczema	Hydrocortisone (NPC18509)	NP level
NCT02419755	Bortezomib and Vorinostat in Younger Patients With Refractory or Relapsed MLL Rearranged Hematologic Malignancies	acute leukemia of ambiguous lineage;acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT01450930	Pharmacokinetics of Hydrocortisone After Subcutaneous Administration in Chronic Adrenal Insufficiency	primary adrenal insufficiency	Hydrocortisone (NPC18509)	NP level
NCT00563303	Treatment of Polytraumatisms With Corticoids	injury	Hydrocortisone (NPC18509)	NP level
NCT00618501	Imatinib Mesylate and Combination Chemotherapy With or Without a Donor Stem Cell Transplant in Treating Patients With Newly Diagnosed Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00186628	Phase 2 Trial of Prophylactic Rituximab Therapy for Prevention of CGVHD	mast-cell leukemia	Hydrocortisone (NPC18509)	NP level
NCT00084838	Chemotherapy Combined With Radiation Therapy for Newly Diagnosed CNS AT/RT	Central Nervous System Neoplasm	Hydrocortisone (NPC18509)	NP level
NCT05063994	Comparison of Chronocort Versus Standard Hydrocortisone Replacement Therapy in Participants Aged 16 Years and Over With Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT03062280	A Study of the Efficacy, Safety and Tolerability of Chronocort in Treating CAH	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT01847690	Effect of Cortisol on Physical Exertion in Patients With Primary Adrenal Failure	chronic primary adrenal insufficiency	Hydrocortisone (NPC18509)	NP level
NCT00006455	Combination Chemotherapy in Treating Children With Anaplastic Large Cell Lymphoma (ALCL 99)	lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00895310	Use of Low Dose Ketoconazole in Prostate Cancer That Does Not Respond to Hormone Therapy and Prior Chemotherapy	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT00165178	Treatment of Acute Lymphoblastic Leukemia in Children	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT03333278	The Vitamin C, Hydrocortisone and Thiamine in Patients With Septic Shock Trial	Sepsis;septic shock	Hydrocortisone (NPC18509)	NP level
NCT00002744	Combination Chemotherapy in Treating Children With Newly Diagnosed Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT01860664	Hydrocortisone Ophthalmic Ointment 0.5% for Treatment of Allergic Conjunctivitis	allergic conjunctivitis	Hydrocortisone (NPC18509)	NP level
NCT03209102	Emotional Regulation and Impulsivity Among Adolescents With Borderline Personality Disorder	Borderline personality disorder	Hydrocortisone (NPC18509)	NP level
NCT00002881	Flutamide, Suramin, and Hydrocortisone in Treating Patients With Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT00002494	Combination Chemotherapy in Treating Patients With Non-Hodgkin's Lymphoma or Acute Lymphocytic Leukemia	leukemia;lymphoma	Hydrocortisone (NPC18509)	NP level
NCT01960530	An Investigational Study of Hydrocortisone	adrenocortical insufficiency	Hydrocortisone (NPC18509)	NP level
NCT00732277	Evaluation of Corticosteroid Therapy in Childhood Severe Sepsis - a Randomised Pilot Study	Sepsis	Hydrocortisone (NPC18509)	NP level
NCT01828515	Vilazodone for Corticosteroid-Induced Memory Impairment	memory impairment	Hydrocortisone (NPC18509)	NP level
NCT02303821	Study of Carfilzomib in Combination With Induction Chemotherapy in Children With Relapsed or Refractory Acute Lymphoblastic Leukemia	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT01007591	A Study Comparing LEO 80190 Ointment With Hydrocortisone Ointment, Both Applied Once Daily in the Treatment of Psoriasis Vulgaris on the Face and Intertriginous Areas	psoriasis vulgaris	Hydrocortisone (NPC18509)	NP level
NCT00003215	Combination Chemotherapy Plus Peripheral Stem Cell Transplantation in Treating Patients With Newly Diagnosed Aggressive Non-Hodgkin's Lymphoma	lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00236925	Efficacy Study of Low-Dose Hydrocortisone Treatment for Fibromyalgia	fibromyalgia	Hydrocortisone (NPC18509)	NP level
NCT00002865	High-Intensity, Brief-Duration Chemotherapy in Treating Patients With Relapsed or Refractory Acute Lymphocytic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00623740	PREMILOC Trial to Prevent Bronchopulmonary Dysplasia in Very Preterm Neonates	bronchopulmonary dysplasia	Hydrocortisone (NPC18509)	NP level
NCT00220454	Effect of Estrogen & Stress for Postmenopausal Women	aging	Hydrocortisone (NPC18509)	NP level
NCT00625209	Activated Protein C and Corticosteroids for Human Septic Shock	septic shock	Hydrocortisone (NPC18509)	NP level
NCT04348305	Hydrocortisone for COVID-19 and Severe Hypoxia	COVID-19;hypoxia	Hydrocortisone (NPC18509)	NP level
NCT00729794	Vasopressin, Epinephrine, and Steroids for Cardiac Arrest	cardiac arrest	Hydrocortisone (NPC18509)	NP level
NCT01867294	Spironolactone in Preventing Rash in Patients With Advanced Cancer Receiving Panitumumab and Cetuximab	cancer	Hydrocortisone (NPC18509)	NP level
NCT03548246	Androgen Reduction in Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT05139849	VAsopressin and STeroids in Addition to Adrenaline in Cardiac Arrest - a Randomized Clinical Trial	cardiac arrest	Hydrocortisone (NPC18509)	NP level
NCT00805285	The Use of Oral Budesonide and Rectal Hydrocortisone for the Treatment of Active Ulcerative Colitis	ulcerative colitis	Hydrocortisone (NPC18509)	NP level
NCT01451515	NHL16: Study For Newly Diagnosed Patients With Acute Lymphoblastic Lymphoma	lymphoblastic lymphoma	Hydrocortisone (NPC18509)	NP level
NCT01064986	The Effects of Hydrocortisone in Endotoxemia in Normal Volunteers	infection	Hydrocortisone (NPC18509)	NP level
NCT04181515	Using rTMS to Explore Neural Mechanisms of Stress-Induced Opioid Use	opioid use disorder	Hydrocortisone (NPC18509)	NP level
NCT00673127	Ketoconazole, Hydrocortisone and Dutasteride in Asymptomatic Hormone Refractory Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT03710187	HCT+F vs. HCT Alone in Critically Ill Medical Septic Shock Patients	septic shock	Hydrocortisone (NPC18509)	NP level
NCT00002704	Radiation Therapy and Chemotherapy in Treating Children With CNS Relapse From Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00309894	Ketoconazole, Hydrocortisone, and GM-CSF in Treating Patients With Progressive Prostate Cancer After Hormone Therapy	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT01913158	Safety and Efficacy Study of Anucort HC TM 25mg Rectal Suppositories to Treat Symptomatic Internal Hemorrhoids	hemorrhoid	Hydrocortisone (NPC18509)	NP level
NCT03261336	Oral Calcitriol With Ketoconazole in CRPC	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT01735617	Pilot Study to Characterize and Examine the Pharmacokinetics and Efficacy of Chronocort® in Adults With CAH	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT02790788	Physiologic Effects of Steroids in Cardiac Arrest	cardiac arrest	Hydrocortisone (NPC18509)	NP level
NCT01070225	Reversal of Acute β-Blocker Induced Bronchoconstriction	asthma	Hydrocortisone (NPC18509)	NP level
NCT03649633	Vitamin C, Steroids, and Thiamine, and Cerebral Autoregulation and Functional Outcome in Septic Shock	septic shock	Hydrocortisone (NPC18509)	NP level
NCT03020030	Treatment of Newly Diagnosed Acute Lymphoblastic Leukemia in Children and Adolescents	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT00859781	177Lu Radiolabeled Monoclonal Antibody HuJ591 (177Lu-J591) and Ketoconazole in Patients With Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT00002700	Chemotherapy With or Without Bone Marrow Transplantation in Treating Patients With Acute Lymphoblastic Leukemia	leukemia;lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00482053	Phase 2 Poor Risk DLBCL of TLI and ATG Followed by Matched Allogeneic HT as Consolidation to Autologous HCT	diffuse large B-cell lymphoma	Hydrocortisone (NPC18509)	NP level
NCT03237689	Effects of Glucocorticoids on Cognition in HIV-infected Women	HIV infection	Hydrocortisone (NPC18509)	NP level
NCT04293562	A Study to Compare Standard Chemotherapy to Therapy With CPX-351 and/or Gilteritinib for Patients With Newly Diagnosed AML With or Without FLT3 Mutations	acute myeloid leukemia	Hydrocortisone (NPC18509)	NP level
NCT00003593	Chemotherapy in Treating Children With Down Syndrome and Myeloproliferative Disorder, Acute Myelogenous Leukemia, or Myelodysplastic Syndrome	leukemia;myelodysplastic syndrome;myeloproliferative disorder	Hydrocortisone (NPC18509)	NP level
NCT01771328	Continuous Subcutaneous Hydrocortisone Infusion in Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT00003436	Combination Chemotherapy With or Without Bone Marrow Transplantation in Treating Children With Acute Myeloid Leukemia	leukemia;myelodysplastic syndrome	Hydrocortisone (NPC18509)	NP level
NCT00375713	Randomized Phase III Study to Evaluate the Efficacy and Safety of Xyzal® (Levocetirizine) vs Zyrtec® (Cetirizine) in Subjects With Dermatitis and Eczema	dermatitis;Eczema	Hydrocortisone (NPC18509)	NP level
NCT01574612	Open Label Safety Study of Xerese Cream in the Treatment of Recurrent Herpes Labialis in Children 6-11 Years Old	Herpes Labialis	Hydrocortisone (NPC18509)	NP level
NCT05222152	Chronocort Versus Plenadren Replacement Therapy in Adults With Adrenal Insufficiency	primary adrenal insufficiency	Hydrocortisone (NPC18509)	NP level
NCT02722200	Investigating the Central and Peripheral Mechanisms by Which Glucocorticoids Affect Hunger	obesity	Hydrocortisone (NPC18509)	NP level
NCT04359511	Efficacy and Safety of Corticosteroids in Oxygen-dependent Patients With COVID-19 Pneumonia	COVID-19	Hydrocortisone (NPC18509)	NP level
NCT00003728	Combination Chemotherapy Plus Steroid Therapy in Treating Children With Acute Lymphoblastic Leukemia or Lymphoblastic Non-Hodgkin's Lymphoma	leukemia;lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00704262	Effect of Calcipotriol Plus Hydrocortisone Ointment on the Adrenal Hormone Balance and Calcium Metabolism in Patients With Psoriasis Vulgaris on the Face and Skin Folds	psoriasis vulgaris	Hydrocortisone (NPC18509)	NP level
NCT00133991	Combination Chemotherapy and Rituximab in Treating Patients With Newly Diagnosed Burkitt's Lymphoma or Leukemia	leukemia;lymphoma	Hydrocortisone (NPC18509)	NP level
NCT01399268	Steroids in Bilateral Total Knee Replacement	inflammation	Hydrocortisone (NPC18509)	NP level
NCT01036594	Ketoconazole and Dexamethasone in Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT00621985	Dexamethasone Treatment of Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT00019409	Radiation Therapy to the Head or Intrathecal Chemotherapy Plus High Dose Cytarabine in Preventing CNS Disease in Children With Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00005802	Chemotherapy Followed by Donor White Blood Cells Plus Interleukin-2 in Treating Patients With Acute Myeloid or Lymphocytic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00915343	Once-daily Oral Modified Release Hydrocortisone in Patients With Adrenal Insufficiency	adrenocortical insufficiency	Hydrocortisone (NPC18509)	NP level
NCT03592693	Vitamin C, Hydrocortisone and Thiamine for Septic Shock	septic shock	Hydrocortisone (NPC18509)	NP level
NCT02735707	Randomized, Embedded, Multifactorial Adaptive Platform Trial for Community- Acquired Pneumonia	COVID-19;influenza;pneumonia	Hydrocortisone (NPC18509)	NP level
NCT00098839	Chemoimmunotherapy With Epratuzumab in Relapsed Acute Lymphoblastic Leukemia (ALL)	childhood acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT01104025	Hybrid Immunotherapy for Hemophagocytic LymphoHistiocytosis	hemophagocytic syndrome	Hydrocortisone (NPC18509)	NP level
NCT00002552	Chemotherapy Plus Bone Marrow Transplantation in Treating Patients With Refractory Non-Hodgkin's Lymphoma, Hodgkin's Disease, or Multiple Myeloma	multiple myeloma	Hydrocortisone (NPC18509)	NP level
NCT02473263	Samu Save Sepsis: Early Goal Directed Therapy in Pre Hospital Care of Patients With Severe Sepsis and/or Septic Shock	Sepsis	Hydrocortisone (NPC18509)	NP level
NCT03509350	Vitamin C, Thiamine, and Steroids in Sepsis	Sepsis	Hydrocortisone (NPC18509)	NP level
NCT00358748	Early Use of Hydrocortisone in Hypotensive Very Low Birth Weight Infants	hypotension	Hydrocortisone (NPC18509)	NP level
NCT03019614	An Open Label Study in Healthy Volunteers to Compare Chronocort® to Hydrocortisone	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT00980876	A Comparative Study Between Two Formulations of the Ciprofloxacin Hydrochloride + Hydrocortisone Otic Suspension	otitis externa	Hydrocortisone (NPC18509)	NP level
NCT01859312	Comparison of Cortisol Pump With Standard Treatment for Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT02714543	Evaluation of Efficacy of Aloevera in the Treatment of Oral Submucous Fibrosis- A Clinical Study	oral submucous fibrosis	Hydrocortisone (NPC18509)	NP level
NCT00002471	Combination Chemotherapy in Treating Patients With Acute B-Lymphoblastic Leukemia or Non-Hodgkin's Lymphoma	leukemia;lymphoma	Hydrocortisone (NPC18509)	NP level
NCT00320099	Combination of Corticotherapy and Intensive Insulin Therapy for Septic Shock	septic shock	Hydrocortisone (NPC18509)	NP level
NCT03682393	Post-operative Corticosteroid Treatment After Mitral Valve Surgery	atrial fibrillation	Hydrocortisone (NPC18509)	NP level
NCT00590018	Corticosteroids in Postoperative Critically Ill Neonates With Low Cardiac Output Syndrome With Congenital Heart Disease	heart failure	Hydrocortisone (NPC18509)	NP level
NCT00002805	Combination Chemotherapy in Treating Patients With Acute Myeloid Leukemia or Myelodysplastic Syndrome	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00400946	Treatment of Acute Lymphoblastic Leukemia in Children	leukemia	Hydrocortisone (NPC18509)	NP level
NCT04231708	Effects of Pharmacological Stress and rTMS on Executive Function in Opioid Use Disorder	opioid use disorder	Hydrocortisone (NPC18509)	NP level
NCT00670254	Hydrocortisone for Prevention of Septic Shock	Sepsis	Hydrocortisone (NPC18509)	NP level
NCT03872011	Vitamin C, Thiamine and Hydrocortisone for the Treatment of Septic Shock	septic shock	Hydrocortisone (NPC18509)	NP level
NCT00002757	TITLE:Less Intensive Therapy for Children With Non-Hodgkin's Lymphoma	leukemia;lymphoma	Hydrocortisone (NPC18509)	NP level
NCT03913559	Inotuzumab Ozogamicin for Children With MRD Positive CD22+ Lymphoblastic Leukemia	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT04921189	Steroid, Thiamine and Ascorbic Acid for Comatose Out-of-hospital Cardiac Arrest Survivors	cardiac arrest	Hydrocortisone (NPC18509)	NP level
NCT01941589	Corticosteroids+5-aminosalicylic Acid Compared to Corticosteroids in the Treatment of Moderate-severe Ulcerative Colitis	ulcerative colitis	Hydrocortisone (NPC18509)	NP level
NCT00002921	S9427, Suramin in Treating Patients With Stage III or Stage IV Adrenocortical Cancer Incurable by Surgery	adrenal cortex carcinoma	Hydrocortisone (NPC18509)	NP level
NCT02602210	Supplemental Corticosteroids in Cirrhotic Hypotensive Patients With Suspicion of Sepsis	cirrhosis of liver	Hydrocortisone (NPC18509)	NP level
NCT00027859	Hormone Therapy Compared With Combination Chemotherapy in Treating Patients With Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT00006371	A Phase II Trial of Early Medical Adrenalectomy for "D0.5" Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT02096510	Ultradian Subcutaneous Hydrocortisone Infusion in Addison Disease and Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT00623766	Evaluation of Tumor Response to Ipilimumab in the Treatment of Melanoma With Brain Metastases	melanoma	Hydrocortisone (NPC18509)	NP level
NCT00176462	CINJALL: Treatment for Children With Acute Lymphocytic Leukemia	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT03936517	Safety and Efficacy of Prednisolone in Adrenal Insufficiency Disease (PRED-AID Study)	adrenocortical insufficiency	Hydrocortisone (NPC18509)	NP level
NCT00002785	Combination Chemotherapy, Bone Marrow Transplantation, and Radiation Therapy in Treating Infants With Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00536991	Calcitriol in Combination With Ketoconazole and Therapeutic Hydrocortisone in Treating Patients With Prostate Cancer	prostate adenocarcinoma	Hydrocortisone (NPC18509)	NP level
NCT03371784	The Effect of Glucocorticoid Therapy on Left Ventricular Remodelling in Acute Myocardial Infarction (RECONSIDER)	myocardial infarction	Hydrocortisone (NPC18509)	NP level
NCT01186328	EZN-3042 Administered With Re-induction Chemotherapy in Children With Relapsed Acute Lymphoblastic Leukemia (ALL)	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT03071276	Selinexor in Combination With Fludarabine and Cytarabine in Patients With Refractory or Relapsed Acute Myeloid Leukemia	acute myeloid leukemia	Hydrocortisone (NPC18509)	NP level
NCT00001521	Three Drug Combination Therapy Versus Conventional Treatment of Children With Congenital Adrenal Hyperplasia	congenital adrenal hyperplasia	Hydrocortisone (NPC18509)	NP level
NCT00002756	Induction Intensification in Treating Infants With Newly Diagnosed Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00136435	A Study in Adults With Untreated Acute Lymphoblastic Leukemia	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT00004669	Phase II Pilot Study of Early Cortisol Replacement to Prevent Bronchopulmonary Dysplasia	bronchopulmonary dysplasia	Hydrocortisone (NPC18509)	NP level
NCT00004034	Treatment of Childhood Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT00460031	Treating Patients With Prostate Cancer That Did Not Respond to Hormone Therapy	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT02517489	Community-Acquired Pneumonia : Evaluation of Corticosteroids	pneumonia	Hydrocortisone (NPC18509)	NP level
NCT00519818	Comparison of Two Forms of Hydrocortisone in Patients With Congenital Adrenal Hyperplasia	classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Hydrocortisone (NPC18509)	NP level
NCT00002855	Chemotherapy Plus Hormone Therapy Versus Androgen Suppression in Treating Patients With Metastatic or Unresectable Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT02212561	Selinexor With Fludarabine and Cytarabine for Treatment of Refractory or Relapsed Leukemia or Myelodysplastic Syndrome	acute lymphoblastic leukemia;myelodysplastic syndrome	Hydrocortisone (NPC18509)	NP level
NCT03007147	Imatinib Mesylate and Combination Chemotherapy in Treating Patients With Newly Diagnosed Philadelphia Chromosome Positive Acute Lymphoblastic Leukemia	T-cell acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT01453686	A Trial of Clobetasol Propionate Versus Hydrocortisone in Children With Alopecia Areata	alopecia areata	Hydrocortisone (NPC18509)	NP level
NCT05276323	Medihoney® Derma Cream Treatment for Mild to Moderate Atopic Dermatitis in Children Study	atopic eczema	Hydrocortisone (NPC18509)	NP level
NCT05160506	Corticosteroids to Treat Pancreatitis	pancreatitis	Hydrocortisone (NPC18509)	NP level
NCT00640822	Efficacy and Safety of Calcipotriol Plus Hydrocortisone Ointment Compared With Tacalcitol Ointment in Patients With Psoriasis on the Face and Skin Folds	psoriasis vulgaris	Hydrocortisone (NPC18509)	NP level
NCT01063569	Glucocorticoid Treatment in Addison's Disease	chronic primary adrenal insufficiency	Hydrocortisone (NPC18509)	NP level
NCT00002816	Combination Chemotherapy in Treating Children With Relapsed Acute Lymphoblastic Leukemia	leukemia	Hydrocortisone (NPC18509)	NP level
NCT03670212	Investigation of Nicotine Seeking Behavior in Current Smokers	nicotine dependence	Hydrocortisone (NPC18509)	NP level
NCT00181597	Trilostane for Androgen-Independent Prostate Cancer	prostate adenocarcinoma	Hydrocortisone (NPC18509)	NP level
NCT02196142	Acute Effects of Cortisol on Alcohol Craving in Alcohol Dependence	alcohol dependence	Hydrocortisone (NPC18509)	NP level
NCT01574014	Glucocorticoid Treatment for Social Phobia	phobic disorder	Hydrocortisone (NPC18509)	NP level
NCT01265017	Role of Pregnancy Related Hormones in Lowering the Insulin Requirement in Pregnant Women With Type 1 Diabetes	type 1 diabetes mellitus	Hydrocortisone (NPC18509)	NP level
NCT03349281	Pevonedistat With VXLD Chemotherapy for Adolescent/Young Adults With Relapsed/Refractory ALL or Lymphoblastic NHL	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT00691002	Efficacy and Safety of Calcipotriol Plus Hydrocortisone Ointment in Psoriasis Vulgaris on the Face and Skin Folds	psoriasis vulgaris	Hydrocortisone (NPC18509)	NP level
NCT00002760	Antiandrogen Withdrawal in Treating Patients With Hormone-Refractory Prostate Cancer	prostate cancer	Hydrocortisone (NPC18509)	NP level
NCT00002798	Combination Chemotherapy With or Without Bone Marrow Transplantation in Treating Children With Acute Myelogenous Leukemia or Myelodysplastic Syndrome	acute erythroleukemia;acute megakaryoblastic leukaemia;acute monocytic leukemia;acute myeloblastic leukemia without maturation;acute myelomonocytic leukemia;chronic myelomonocytic leukemia;refractory anemia;refractory anemia with excess blasts	Hydrocortisone (NPC18509)	NP level
NCT00705822	Combination of Docetaxel + Estramustine + Hydrocortisone Versus Docetaxel + Prednisone in Patients With Advanced Prostate Cancer	prostate adenocarcinoma	Hydrocortisone (NPC18509)	NP level
NCT03817320	PO Ixazomib in Combination With Chemotherapy for Childhood Relapsed or Refractory Acute Lymphoblastic Leukemia and Lymphoblastic Lymphoma	acute lymphoblastic leukemia;lymphoblastic lymphoma	Hydrocortisone (NPC18509)	NP level
NCT02101853	Blinatumomab in Treating Younger Patients With Relapsed B-cell Acute Lymphoblastic Leukemia	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT00131053	Applying Pediatric Regimens to Younger Adult Patients With Acute Lymphoblastic Leukemia (ALL)	acute lymphoblastic leukemia	Hydrocortisone (NPC18509)	NP level
NCT02270788	Crenolanib in Combination With Sorafenib in Patients With Refractory or Relapsed Hematologic Malignancies	acute myeloid leukemia	Hydrocortisone (NPC18509)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Septic shock Disease Category: X.Extension Codes Disease ICD-11 Code: XS26	NCT03872011,NCT03333278,NCT00625209,NCT00320099,NCT03649633,NCT03592693,NCT03710187
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NR3C1,NFKB1,NR3C1 NCT05276323,NCT00375713,NCT02465606
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1 NCT02270788,NCT04293562,NCT00002798,NCT03071276
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1 NCT00691002,NCT01007591,NCT00704262,NCT00640822
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	NCT00670254,NCT03333278,NCT02473263,NCT00732277,NCT03509350
Cardiac arrest Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MC82	NCT00729794,NCT04921189,NCT00676585,NCT05139849,NCT02790788
Precursor B-lymphoblastic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A70	NCT01451515,NCT03817320,NCT02043587,NCT00873093,NCT02535806
Adrenocortical insufficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A74	NCT05222152,NCT01960530,NCT01450930,NCT00915343,NCT03936517
Opioid use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C43	ADRA2A NCT01718964,NCT04231708,NCT04181515
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	HRH3,ADRA2A,ADRA2C,NR3C1
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	SERPINA6 NCT00181597,NCT00705822,NCT00536991
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	SERPINA6,HIF1A,ADRA2C,SMN1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	HRH3,NR3C1,ADRA2A,ADRA2C
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	NR3C1,HRH3,ADRA2C
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	NR3C1,ADRA2C NCT01064986
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	NR3C1,HIF1A,NFKB1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NR3C1,SERPINA6 NCT01070225
Ulcerative colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD71	NCT02425852,NCT00805285,NCT01941589
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	NCT00003436,NCT02212561,NCT00003593
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04359511,NCT02735707,NCT04348305
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	HRH3,NR3C1,ADRA2A
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	ADRA2A,HIF1A,ADRA2C
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ADRA2A,ADRA2C,SMN1
Leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60-2B33	NCT00002471,NCT00002816,NCT00002700,NCT00004034,NCT00002494,NCT00003593,NCT00002785,NCT00400946,NCT00002757,NCT00618501,NCT00019409,NCT00003728,NCT00003436,NCT00002805,NCT00002744,NCT00133991,NCT00002756,NCT00002865,NCT00005802,NCT00002704
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	ADRA2C NCT00358748
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	NR3C1,SERPINA6
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	ADRA2A,HRH3
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A,ADRA2C
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	ADRA2C,HRH3
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1,NR3C1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NR3C1,NFKB1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ADRA2C,ADRA2A
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	NR3C1,SERPINA6
Otitis externa Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA00-AA13	NR3C1 NCT00980876
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN2,SMN1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1,NR3C1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1,NR3C1
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	ADRA2A,NR3C1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HRH3,ADRA2C
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1,NR3C1
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	ADRA2C NCT02722200
Pneumonia Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40	NCT02735707,NCT02517489
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	NCT01014364,NCT02735707
Acquired adrenocortical insufficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A74.0	NCT01847690,NCT01063569
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	NCT00002552,NCT00899847
Bronchopulmonary dysplasia originating in the perinatal period Disease Category: 19.Certain conditions originating in the perinatal period Disease ICD-11 Code: KB29.0	NCT00623740,NCT00004669
Acute leukaemias of ambiguous lineage Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A61	NCT02419755,NCT04898894
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HRH3,SERPINA6
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	ADRA2A,SMN1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HRH3,ADRA2C
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	NFKB1,ADRA2C
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	HRH3,SERPINA6
Precursor cell lymphoblastic leukaemia, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH5J37	NCT03349281,NCT00098839,NCT00136435,NCT02043587,NCT00176462,NCT03817320,NCT00165178,NCT02101853,NCT02535806,NCT00131053,NCT03020030,NCT02212561,NCT01186328,NCT03913559,NCT02419755,NCT02303821
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NR3C1 NCT03261336,NCT00027859,NCT00309894,NCT00953576,NCT01036594,NCT00895310,NCT00002881,NCT00002855,NCT00006371,NCT00673127,NCT00460031,NCT00002760,NCT00859781
Congenital adrenal hyperplasia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A71.01	NCT01735617,NCT03548246,NCT00001521,NCT03019614,NCT02096510,NCT01771328,NCT01859312,NCT05063994,NCT03062280,NCT00621985,NCT00519818
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	HIF1A NCT00002757,NCT00392834,NCT00003215,NCT00006455,NCT00002494,NCT00003728,NCT00002471,NCT00002700,NCT00133991
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	HRH3
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	HRH3
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	ADRA2C
Respiratory system disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB40-CB7Z	SERPINA6
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	NR3C1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HRH3
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Spine/trunk injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND51	NR3C1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	NR3C1
Post-traumatic stress disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B40	ADRA2C
Adaptive immunity immunodeficiency Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A01	NR3C1
Non-specific cutaneous vascular sympton Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME64	ADRA2C
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	NR3C1
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Sleep-wake disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7B2Z	HRH3
Adrenogenital disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A71	NR3C1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NR3C1
Narcolepsy Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A20	HRH3
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	ADRA2C
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ADRA2C
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	HRH3
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	NR3C1
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	ADRA2C
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	ADRA2C
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	NR3C1
Vitamin deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B55-5B5F	NR3C1
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NR3C1
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A
Somnolence Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG42	HRH3
Asphyxia Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD11.1	NCT04348305
Hepatic fibrosis/cirrhosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB93	NCT02602210
Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62.Z	NCT03237689
Pancreatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DC31-DC34	NCT05160506
Central nervous system disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A04-8D87	NCT00084838
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	NCT03670212
Acute myelomonocytic leukaemia Disease Category: X.Extension Codes Disease ICD-11 Code: XH78Y4	NCT00002798
Anaplastic large cell lymphoma, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH1LC0	NCT00354107
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT01867294
Acute erythroid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60.35	NCT00002798
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	NCT00002798
Herpes simplex labialis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00.01	NCT01574612
Adult T-cell lymphoma or leukaemia, human T-cell lymphotropic virus type 1-associated Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90.5	NCT03007147
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	NCT00563303
Refractory anaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A30	NCT00002798
Chronic widespread pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30.01	NCT00236925
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NCT00623766
Acute megakaryoblastic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60.36	NCT00002798
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	NCT03682393
Primary haemophagocytic lymphohistiocytosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A01.23	NCT01104025
Haemorrhoids Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB60	NCT01913158
NA Disease Category: NA Disease ICD-11 Code: NA	NCT01399268
Adrenal cortical carcinoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH4KH2	NCT00002921
Viral pneumonia Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.1	NCT01014364
Age-associated cognitive decline Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21.0	NCT01828515
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	NCT00003593
Allergic conjunctivitis Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A60.02	NCT01860664
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	NCT00590018
Acute monocytic leukaemia Disease Category: X.Extension Codes Disease ICD-11 Code: XH9NE2	NCT00002798
Anxiety or fear-related disorders, unspecified Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B0Z	NCT01574014
Type1diabetesmellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10	NCT01265017
Dermatitis or eczema, unspecified Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA8Z	NCT00375713
Insulin-resistance syndromes Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A44	NCT02256865
Refractory anaemia with excess of blasts Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A35	NCT00002798
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	NCT03371784
Mast cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21.00	NCT00186628
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT00220454
Alopecia areata Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED70.2	NCT01453686
Personality disorder, severity unspecified Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D10.Z	NCT03209102
Burkitt-like lymphoma with 11q aberration Disease Category: X.Extension Codes Disease ICD-11 Code: XH8NN2	NCT00873093
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	NCT00482053
Oral submucous fibrosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA02.2	NCT02714543
Alcohol dependence Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40.2	NCT02196142
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ADRA2C
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	ADRA2C
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	SERPINA6
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	ADRA2A
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HIF1A
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	ADRA2C
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ADRA2A
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	SERPINA6
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	ADRA2C
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ADRA2A
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HRH3
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	HIF1A

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Protea Compacta

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

93 All known Ingredients in Total

66 Ingredients with Acceptable Bioavailablity

10 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Septic shock

Atopic eczema

Acute myeloid leukaemia

Psoriasis

Sepsis

Cardiac arrest

Precursor B-lymphoblastic neoplasm

Adrenocortical insufficiency

Opioid use disorder

Substance abuse

Adenocarcinoma of prostate

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

Vasomotor/allergic rhinitis

Herpes simplex infection

Solid tumour/cancer

Asthma

Ulcerative colitis

Myelodysplastic syndrome

COVID-19

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Diffuse large B-cell lymphomas

Leukaemia

Hypotension

Postoperative inflammation

Attention deficit hyperactivity disorder

Pulmonary hypertension

Chronic pain

Type 2 diabetes mellitus

Multiple sclerosis

Pain, unspecified

Retinopathy

Otitis externa

Muscular atrophy

Indeterminate colitis

Rheumatoid arthritis

Depression

Alzheimer disease

Muscular dystrophy

Obesity

Pneumonia

Influenza

Acquired adrenocortical insufficiency

Multiple myeloma

Bronchopulmonary dysplasia originating in the perinatal period

Acute leukaemias of ambiguous lineage

Carcinosarcoma of uterus

Mesothelioma of pleura

Cytomegaloviral disease

Malignant neoplasms of thymus

Invasive carcinoma of breast

Precursor cell lymphoblastic leukaemia, NOS

Prostate cancer

Congenital adrenal hyperplasia

Mature T-cell lymphoma

Dementia

Mild neurocognitive disorder

General pain disorder

Respiratory system disease

Oesophagitis

Schizophrenia

Acute/subacute hepatic failure

Spine/trunk injury