• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vachellia Karroo


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATGCCCCGAGAGAAGAACGACCCGCGGACCGGTTGGCGCACAGACCCGTGGCCGGGGAGGGCGGAGCCCCCCGGCAACCAAAGTCCCCGGCGCCCCAGGCGCCAAGGAGCAGCAACAGAGCGGGGCACGGCCGAGCGCCGCGCCCCACGCGTCCTAGCGTATCCTAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO1079
Plant Latin Name: Vachellia Karroo
Taxonomy Genus: Vachellia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 138024
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Madagascar; Zimbabwe; Angola; Swaziland; South Africa

Traditional Medicine System:

Geographical Distribution

Madagascar; Zimbabwe; Angola; Swaziland; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

38 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


35 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88168

Ingredient ID: NPC69712

Ingredient ID: NPC68889

Ingredient ID: NPC67508

Ingredient ID: NPC66272

Ingredient ID: NPC60186

Ingredient ID: NPC5687

Ingredient ID: NPC54145

Ingredient ID: NPC34216

Ingredient ID: NPC32351

Ingredient ID: NPC312904

Ingredient ID: NPC310907

Ingredient ID: NPC310210

Ingredient ID: NPC306843

Ingredient ID: NPC291497

Ingredient ID: NPC289653

Ingredient ID: NPC285267

Ingredient ID: NPC26240

Ingredient ID: NPC240308

Ingredient ID: NPC237408

Ingredient ID: NPC235564

Ingredient ID: NPC222154

Ingredient ID: NPC221467

Ingredient ID: NPC22098

Ingredient ID: NPC218742

Ingredient ID: NPC214584

Ingredient ID: NPC212794

Ingredient ID: NPC210560

Ingredient ID: NPC205421

Ingredient ID: NPC192135

Ingredient ID: NPC182907

Ingredient ID: NPC178662

Ingredient ID: NPC168683

Ingredient ID: NPC154847

Ingredient ID: NPC136508

Ingredient ID: NPC12319

Ingredient ID: NPC114526

Ingredient ID: NPC111888