• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cistanche Deserticola


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGTAGAAGCAAACCGCGAACATGTATAATCACATTGGGATTGCGGCGGGGACAATCTCTCGTCGCATCCCCCTCCCCGCATGCTCTCACCATGGTGGGCGTTGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGATTACTCATGAAGCGTCCACCTCCCCCGTCCCGTTCGCGGTGATTTGGGGGAAGAGGATGAATCTCCAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCTCCGTCCCTTTGGGGCGATACTGGGGGGGCGGACAATGGCCTCCCGTGCATTAYTGATGTGCGGCCGGCCTAAATGGGATCCTGCGGCGACTCACGTCACGACCAGTGGTGGTTGAACTCTCAACTCTCGTGCTGTTGTGTCGTATGGCGTCGAATGGTAGACATTGTCGCATACCCAATCGTGTGATATATTCACGCTTTTGACCGCGACCCCA

Click for details-----ITS1

TTGTCGAATCCTGTAGAAGCAAACCGCGAACATGTATAATCACATTGGGATTGCGGCGGGGGCAATCTCTTGTCGCATCCCCCTCCCCGCATGCTCTCACCATGGTGGGTGTTGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGATTACTCATGAAGCGTCCACCTCCCCTGTCCCGTTCGCGGTGATTTTGGGGGAAGAGGATGAATCTCAAAA

Click for details-----ITS2

ATCGCGTCGCTCCCCTCCGTCCCTTTGGGGCGATACTGGGGGGGCGGACAATGGCCTCCCGTGCATTAYTGATGTGCGGCCGGCCTAAATGGGATCCTGCGGCGACTCACGTCACGACCAGTGGTGGTTGAACTCTCAACTCTCGTGCTGTTGTGTCGTATGGCGTCGAATGGTAGACATTGTCGCATACCCAATCGTGTGATATATTCACGCTTTTGACCGCGACCCCA
Taxonomic Information

Plant ID: NPO10680
Plant Latin Name: Cistanche Deserticola
Taxonomy Genus: Cistanche
Taxonomy Family: Orobanchaceae

Plant External Links:

NCBI TaxonomyDB: 161395
Plant-of-the-World-Online: 957757-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China; Mongolia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

153 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


84 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

55 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98163

Ingredient ID: NPC95392

Ingredient ID: NPC94336

Ingredient ID: NPC93201

Ingredient ID: NPC89297

Ingredient ID: NPC88085

Ingredient ID: NPC86412

Ingredient ID: NPC84938

Ingredient ID: NPC83268

Ingredient ID: NPC82391

Ingredient ID: NPC76443

Ingredient ID: NPC76406

Ingredient ID: NPC73906

Ingredient ID: NPC64141

Ingredient ID: NPC62139

Ingredient ID: NPC60154

Ingredient ID: NPC59650

Ingredient ID: NPC57429

Ingredient ID: NPC53541

Ingredient ID: NPC52256

Ingredient ID: NPC51862

Ingredient ID: NPC51843

Ingredient ID: NPC49103

Ingredient ID: NPC49074

Ingredient ID: NPC47471

Ingredient ID: NPC46137

Ingredient ID: NPC45873

Ingredient ID: NPC43257

Ingredient ID: NPC42459

Ingredient ID: NPC42150

Ingredient ID: NPC41223

Ingredient ID: NPC39558

Ingredient ID: NPC38752

Ingredient ID: NPC37819

Ingredient ID: NPC37240

Ingredient ID: NPC37132

Ingredient ID: NPC3488

Ingredient ID: NPC34587

Ingredient ID: NPC34125

Ingredient ID: NPC34103

Ingredient ID: NPC3295

Ingredient ID: NPC329148

Ingredient ID: NPC32419

Ingredient ID: NPC323787

Ingredient ID: NPC323434

Ingredient ID: NPC318802

Ingredient ID: NPC315224

Ingredient ID: NPC313851

Ingredient ID: NPC306397

Ingredient ID: NPC305185

Ingredient ID: NPC300969

Ingredient ID: NPC300228

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC298257

Ingredient ID: NPC295589

Ingredient ID: NPC293908

Ingredient ID: NPC291309

Ingredient ID: NPC287352

Ingredient ID: NPC285364

Ingredient ID: NPC284342

Ingredient ID: NPC274904

Ingredient ID: NPC272614

Ingredient ID: NPC271027

Ingredient ID: NPC270699

Ingredient ID: NPC270199

Ingredient ID: NPC264726

Ingredient ID: NPC262451

Ingredient ID: NPC26229

Ingredient ID: NPC260545

Ingredient ID: NPC258227

Ingredient ID: NPC258130

Ingredient ID: NPC257885

Ingredient ID: NPC257124

Ingredient ID: NPC254474

Ingredient ID: NPC254053

Ingredient ID: NPC249422

Ingredient ID: NPC249045

Ingredient ID: NPC248355

Ingredient ID: NPC243728

Ingredient ID: NPC242742

Ingredient ID: NPC242603

Ingredient ID: NPC241911

Ingredient ID: NPC240911

Ingredient ID: NPC239478

Ingredient ID: NPC239406

Ingredient ID: NPC236709

Ingredient ID: NPC235294

Ingredient ID: NPC234209

Ingredient ID: NPC229786

Ingredient ID: NPC228346

Ingredient ID: NPC223455

Ingredient ID: NPC222433

Ingredient ID: NPC22140

Ingredient ID: NPC220089

Ingredient ID: NPC219143

Ingredient ID: NPC217922

Ingredient ID: NPC215578

Ingredient ID: NPC209970

Ingredient ID: NPC202600

Ingredient ID: NPC198311

Ingredient ID: NPC197840

Ingredient ID: NPC197503

Ingredient ID: NPC197316

Ingredient ID: NPC196359

Ingredient ID: NPC190771

Ingredient ID: NPC180102

Ingredient ID: NPC180058

Ingredient ID: NPC179203

Ingredient ID: NPC177747

Ingredient ID: NPC176521

Ingredient ID: NPC175214

Ingredient ID: NPC174246

Ingredient ID: NPC17378

Ingredient ID: NPC170065

Ingredient ID: NPC168326

Ingredient ID: NPC16588

Ingredient ID: NPC165159

Ingredient ID: NPC164700

Ingredient ID: NPC161360

Ingredient ID: NPC160359

Ingredient ID: NPC153572

Ingredient ID: NPC152451

Ingredient ID: NPC152384

Ingredient ID: NPC152345

Ingredient ID: NPC146374

Ingredient ID: NPC14526

Ingredient ID: NPC14503

Ingredient ID: NPC144628

Ingredient ID: NPC144233

Ingredient ID: NPC142836

Ingredient ID: NPC142753

Ingredient ID: NPC141765

Ingredient ID: NPC14076

Ingredient ID: NPC136996

Ingredient ID: NPC132311

Ingredient ID: NPC129456

Ingredient ID: NPC127122

Ingredient ID: NPC124004

Ingredient ID: NPC12367

Ingredient ID: NPC11609

Ingredient ID: NPC115247

Ingredient ID: NPC114705

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111897

Ingredient ID: NPC111625

Ingredient ID: NPC110511

Ingredient ID: NPC107991

Ingredient ID: NPC10781

Ingredient ID: NPC106764

Ingredient ID: NPC106551

Ingredient ID: NPC100452