• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vitex Megapotamica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAGCAGACCGTGAACATGTGTTTAACCATAATGGGGACGCGGTGCGGAGGCGAGCATGCCTTCCTCCCGTCGCATCCCCACCCCCGTCGGCGCGGGCGCTAGCGCCTCGCATCGTGCGGGCTAACGAAACCCCGGCGCGGCATGCGCCAAGGAAAACAAAAACAAAGCGTTCGCCGCCCGATGCCCCGTTCGCGGAGCGCGCGGGCGGATGGTGCGCCAATCTAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCACTCGCGCACTGCGCTTGCGATGGGGGGACGGAGAATGGCTTCCCGTGACTCTTGGCGCGGCCGGCCCAAATGTGATCCCTCGGCGACGCACGTCACGACCAGTGGTGGTTGAATCTCAACTCGCATGCTGTCGTGCGGTGCGGCGTCGTCCGAAGTGGCATCAAAGATAACCCAACGGCGTATTAAGCCTCCGACCGCGACCCCAGGTCAGGCGGGATCACCCG

Click for details-----ITS1

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAGCAGACCGTGAACATGTGTTTAACCATAATGGGGACGCGGTGCGGAGGCGAGCATGCCTTCCTCCCGTCGCATCCCCACCCCCGTCGGCGCGGGCGCTAGCGCCTCGCATCGTGCGGGCTAACGAAACCCCGGCGCGGCATGCGCCAAGGAAAACAAAAACAAAGCGTTCGCCGCCCGATGCCCCGTTCGCGGAGCGCGCGGGCGGATGGTGCGCCAATCTAATGTCATAA

Click for details-----ITS2

ATCGCGTCGCCCCCCACTCGCGCACTGCGCTTGCGATGGGGGGACGGAGAATGGCTTCCCGTGACTCTTGGCGCGGCCGGCCCAAATGTGATCCCTCGGCGACGCACGTCACGACCAGTGGTGGTTGAATCTCAACTCGCATGCTGTCGTGCGGTGCGGCGTCGTCCGAAGTGGCATCAAAGATAACCCAACGGCGTATTAAGCCTCCGACCGCGACCCCAGGTCAGGCGGGATCACCCG
Taxonomic Information

Plant ID: NPO10672
Plant Latin Name: Vitex Megapotamica
Taxonomy Genus: Vitex
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 1365883
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

137 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


81 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

43 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99965

Ingredient ID: NPC97210

Ingredient ID: NPC96102

Ingredient ID: NPC94237

Ingredient ID: NPC9112

Ingredient ID: NPC89842

Ingredient ID: NPC89657

Ingredient ID: NPC87706

Ingredient ID: NPC83284

Ingredient ID: NPC79298

Ingredient ID: NPC78093

Ingredient ID: NPC75389

Ingredient ID: NPC75052

Ingredient ID: NPC74258

Ingredient ID: NPC73631

Ingredient ID: NPC73050

Ingredient ID: NPC64506

Ingredient ID: NPC6193

Ingredient ID: NPC61236

Ingredient ID: NPC60653

Ingredient ID: NPC59006

Ingredient ID: NPC54965

Ingredient ID: NPC48899

Ingredient ID: NPC44295

Ingredient ID: NPC43063

Ingredient ID: NPC3930

Ingredient ID: NPC38772

Ingredient ID: NPC3452

Ingredient ID: NPC32771

Ingredient ID: NPC313186

Ingredient ID: NPC312481

Ingredient ID: NPC311506

Ingredient ID: NPC311047

Ingredient ID: NPC305001

Ingredient ID: NPC304309

Ingredient ID: NPC304276

Ingredient ID: NPC303822

Ingredient ID: NPC299654

Ingredient ID: NPC298278

Ingredient ID: NPC297101

Ingredient ID: NPC295843

Ingredient ID: NPC286799

Ingredient ID: NPC28657

Ingredient ID: NPC281547

Ingredient ID: NPC281016

Ingredient ID: NPC280447

Ingredient ID: NPC280371

Ingredient ID: NPC280224

Ingredient ID: NPC279591

Ingredient ID: NPC278681

Ingredient ID: NPC278214

Ingredient ID: NPC275060

Ingredient ID: NPC273469

Ingredient ID: NPC268826

Ingredient ID: NPC259817

Ingredient ID: NPC259264

Ingredient ID: NPC256645

Ingredient ID: NPC254190

Ingredient ID: NPC25012

Ingredient ID: NPC247852

Ingredient ID: NPC239511

Ingredient ID: NPC236347

Ingredient ID: NPC235413

Ingredient ID: NPC233478

Ingredient ID: NPC232564

Ingredient ID: NPC232533

Ingredient ID: NPC230301

Ingredient ID: NPC228293

Ingredient ID: NPC226575

Ingredient ID: NPC225609

Ingredient ID: NPC224553

Ingredient ID: NPC221584

Ingredient ID: NPC220765

Ingredient ID: NPC217440

Ingredient ID: NPC216531

Ingredient ID: NPC216392

Ingredient ID: NPC215696

Ingredient ID: NPC213956

Ingredient ID: NPC213761

Ingredient ID: NPC212695

Ingredient ID: NPC20620

Ingredient ID: NPC204717

Ingredient ID: NPC200361

Ingredient ID: NPC193295

Ingredient ID: NPC190537

Ingredient ID: NPC190229

Ingredient ID: NPC189863

Ingredient ID: NPC188463

Ingredient ID: NPC186544

Ingredient ID: NPC185287

Ingredient ID: NPC184586

Ingredient ID: NPC184555

Ingredient ID: NPC184101

Ingredient ID: NPC181943

Ingredient ID: NPC18188

Ingredient ID: NPC180792

Ingredient ID: NPC171171

Ingredient ID: NPC171126

Ingredient ID: NPC171014

Ingredient ID: NPC170801

Ingredient ID: NPC166763

Ingredient ID: NPC166002

Ingredient ID: NPC16270

Ingredient ID: NPC162379

Ingredient ID: NPC161252

Ingredient ID: NPC158092

Ingredient ID: NPC157380

Ingredient ID: NPC157154

Ingredient ID: NPC156704

Ingredient ID: NPC155182

Ingredient ID: NPC153589

Ingredient ID: NPC150228

Ingredient ID: NPC149785

Ingredient ID: NPC149683

Ingredient ID: NPC14811

Ingredient ID: NPC146786

Ingredient ID: NPC146221

Ingredient ID: NPC143676

Ingredient ID: NPC142927

Ingredient ID: NPC142397

Ingredient ID: NPC139459

Ingredient ID: NPC138897

Ingredient ID: NPC137462

Ingredient ID: NPC1359

Ingredient ID: NPC13326

Ingredient ID: NPC131593

Ingredient ID: NPC127581

Ingredient ID: NPC126870

Ingredient ID: NPC124275

Ingredient ID: NPC113425

Ingredient ID: NPC112936

Ingredient ID: NPC112776

Ingredient ID: NPC11105

Ingredient ID: NPC107217

Ingredient ID: NPC103491

Ingredient ID: NPC103007

Ingredient ID: NPC100596