• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aconitum Vilmorini


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAGCGACCCGCGAACAAGTGAAAACAAATCTGGACGAACCGAAGAGGGGCGCATGCCCCCGATCGCTCGCCCGTCGGACCACGACCTCTTCTGCGACCGCATTGATCTGCGGGCGGAGGGGTGGGTCGTTGTGTCCGCACAAAACCAAAAACCGGCGCGACAGGCGTCAAGGAAATCTTAGCGGAAAAAGAGGGTTGCCCCGTCCGCGGTGGCAGCCTTCAGAATCCGATACTCAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO10517
Plant Latin Name: Aconitum Vilmorini
Taxonomy Genus: Aconitum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

19 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


19 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC6530

Ingredient ID: NPC36002

Ingredient ID: NPC34103

Ingredient ID: NPC311936

Ingredient ID: NPC307872

Ingredient ID: NPC284413

Ingredient ID: NPC28425

Ingredient ID: NPC278525

Ingredient ID: NPC277921

Ingredient ID: NPC276060

Ingredient ID: NPC249901

Ingredient ID: NPC240847

Ingredient ID: NPC238844

Ingredient ID: NPC22928

Ingredient ID: NPC146703

Ingredient ID: NPC145730

Ingredient ID: NPC128491

Ingredient ID: NPC127491

Ingredient ID: NPC119579