• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Arctium Lappa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAACCTGCGGAAGGATCATTGTCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACCGGGCATCGGGGGGATTGGGTGCGAGCCTGAGCCTTGCGATGCTCCGTCGGCATACGTGCATGGTGCCCCTTACGAGGCATTGTGGATGTTGTGTCGGCACGAAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACCAAACTTAAGAAGGGCGCGTCCTGTGTTGCCCCGTTTGCGGTGTGTGCACGGGTCGTGGCCTCTCATCAAACCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGACCACGCCTCCCCAGTGGGGATGCGTGTCGTTTGGGGCGGAGACTGGTCTCCCGTGCCCATGGTGCGGTTGGCCTAAAAAGGAGTCCCCTTTGACGGACGCACGGCTAGTGGTGGTTGTCAAGGCCTTCGTATCGAGCCGTGCGGACGCAAGGGAAGCGCTCTCCAATGACCCCAACGTGTCGTCTTGCAACGACGCTTCGA

Click for details-----ITS1

TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACTCGGGCATCGGGGGGATTGGGTGCGAGCCTGAGCCTTGCGATGCTTCGTCGGCATACGTGCATGGTGCCCCTTACGAGGCATTGTGGATGTTGTGTCGGCACGAAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACCAAACTTAAGAAGGGCGCGTCCTGTGTTGCCCCGTTTGCGGTGTGCGCACGGGTCGTGGCCTCTCATCAAACCATAAA

Click for details-----ITS2

ATCGCGTCGCCCCCGACCACGCCTCCCCAGTGGGGATGCGTGTCGTTTTGGGGCGGAGACTGGTCTCCCGTGCCCATGGTGCGGTTGGCCTAAAAAGGAGTCCCCTTTGACGGACGCACGGCTAGTGGTGGTTGTCAAGGCCTTCGTATCGAGCCGTGCAGACGCAAGGGAAGCGCTCTCCAATGACCCCAACGTGTCGTCTTGCAACGACGCTCCGACCG
Taxonomic Information

Plant ID: NPO10449
Plant Latin Name: Arctium Lappa
Taxonomy Genus: Arctium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 4217
Plant-of-the-World-Online: 178385-1

Used in Medicines

Country/Region:
India; South Korea; Finland; Italy; China

Traditional Medicine System:
Indian Folk; TCM; Homeopathy; Kampo


Medicinal Functions:

Alterative; Antibacterial; Antifungal; Antiphlogistic; Antipsoriatic; Aperient; Blood purifier; Carminative; Cholagogue; Depurative; Diaphoretic; Diuretic; Hypoglycaemic; Stomachic

Geographical Distribution

Canada; Afghanistan; Italy; Turkmenistan; Nepal; Cambodia; France; Netherlands; Ireland; Laos; Norway; Uzbekistan; Australia; Iceland; China; Belgium; Germany; Kazakhstan; Taiwan; Spain; Ukraine; Georgia; Denmark; Poland; Finland; Turkey; United States; Sweden; Belarus; Japan; Switzerland; New Zealand; Russia; Bulgaria; Romania; Greenland; Portugal; Myanmar; South Africa; Tajikistan; India; United Kingdom; Austria; Vietnam; Greece; Hungary; South Korea; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

165 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


98 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

84 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC97117

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92774

Ingredient ID: NPC88456

Ingredient ID: NPC85813

Ingredient ID: NPC81775

Ingredient ID: NPC78500

Ingredient ID: NPC75883

Ingredient ID: NPC73781

Ingredient ID: NPC72796

Ingredient ID: NPC72775

Ingredient ID: NPC68779

Ingredient ID: NPC66624

Ingredient ID: NPC65606

Ingredient ID: NPC6485

Ingredient ID: NPC62045

Ingredient ID: NPC59650

Ingredient ID: NPC52464

Ingredient ID: NPC51700

Ingredient ID: NPC4982

Ingredient ID: NPC490321

Ingredient ID: NPC490297

Ingredient ID: NPC490296

Ingredient ID: NPC490295

Ingredient ID: NPC490293

Ingredient ID: NPC490292

Ingredient ID: NPC490291

Ingredient ID: NPC490290

Ingredient ID: NPC489990

Ingredient ID: NPC489907

Ingredient ID: NPC461221

Ingredient ID: NPC43300

Ingredient ID: NPC40352

Ingredient ID: NPC40183

Ingredient ID: NPC37331

Ingredient ID: NPC35760

Ingredient ID: NPC35652

Ingredient ID: NPC34738

Ingredient ID: NPC330333

Ingredient ID: NPC328447

Ingredient ID: NPC325585

Ingredient ID: NPC323136

Ingredient ID: NPC323070

Ingredient ID: NPC322666

Ingredient ID: NPC321610

Ingredient ID: NPC321351

Ingredient ID: NPC320828

Ingredient ID: NPC319063

Ingredient ID: NPC317120

Ingredient ID: NPC316301

Ingredient ID: NPC309987

Ingredient ID: NPC30441

Ingredient ID: NPC303090

Ingredient ID: NPC302857

Ingredient ID: NPC301382

Ingredient ID: NPC300776

Ingredient ID: NPC30

Ingredient ID: NPC299706

Ingredient ID: NPC299131

Ingredient ID: NPC296974

Ingredient ID: NPC296894

Ingredient ID: NPC294902

Ingredient ID: NPC294550

Ingredient ID: NPC294548

Ingredient ID: NPC293757

Ingredient ID: NPC291079

Ingredient ID: NPC291027

Ingredient ID: NPC284948

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC273385

Ingredient ID: NPC272614

Ingredient ID: NPC270760

Ingredient ID: NPC270578

Ingredient ID: NPC269919

Ingredient ID: NPC265318

Ingredient ID: NPC26329

Ingredient ID: NPC261831

Ingredient ID: NPC258116

Ingredient ID: NPC255404

Ingredient ID: NPC252126

Ingredient ID: NPC250606

Ingredient ID: NPC243728

Ingredient ID: NPC242924

Ingredient ID: NPC242580

Ingredient ID: NPC24146

Ingredient ID: NPC237812

Ingredient ID: NPC237332

Ingredient ID: NPC236953

Ingredient ID: NPC236141

Ingredient ID: NPC235260

Ingredient ID: NPC230301

Ingredient ID: NPC229882

Ingredient ID: NPC227168

Ingredient ID: NPC226453

Ingredient ID: NPC225913

Ingredient ID: NPC223711

Ingredient ID: NPC223549

Ingredient ID: NPC221250

Ingredient ID: NPC220221

Ingredient ID: NPC220082

Ingredient ID: NPC216514

Ingredient ID: NPC216330

Ingredient ID: NPC214153

Ingredient ID: NPC210354

Ingredient ID: NPC210040

Ingredient ID: NPC209941

Ingredient ID: NPC208793

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC200184

Ingredient ID: NPC197980

Ingredient ID: NPC195000

Ingredient ID: NPC192638

Ingredient ID: NPC190771

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC18205

Ingredient ID: NPC181045

Ingredient ID: NPC17810

Ingredient ID: NPC176814

Ingredient ID: NPC174596

Ingredient ID: NPC174246

Ingredient ID: NPC173637

Ingredient ID: NPC1682

Ingredient ID: NPC167976

Ingredient ID: NPC167400

Ingredient ID: NPC166442

Ingredient ID: NPC164311

Ingredient ID: NPC158756

Ingredient ID: NPC158737

Ingredient ID: NPC158088

Ingredient ID: NPC157944

Ingredient ID: NPC154172

Ingredient ID: NPC15336

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC146289

Ingredient ID: NPC142703

Ingredient ID: NPC142227

Ingredient ID: NPC138021

Ingredient ID: NPC137958

Ingredient ID: NPC137646

Ingredient ID: NPC137309

Ingredient ID: NPC136014

Ingredient ID: NPC135000

Ingredient ID: NPC133474

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126548

Ingredient ID: NPC120468

Ingredient ID: NPC117930

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC109500

Ingredient ID: NPC108779

Ingredient ID: NPC108598

Ingredient ID: NPC1075

Ingredient ID: NPC106387

Ingredient ID: NPC104195