• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Fragaria X Ananassa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGAAGGATCATTGTCGAAACCTGCATGGCAGAACGACCCGAGAACACGTTCCGACGCTCGGGGGCGGGGGGTCTCGCGGCTCCTCGCCCCCACCTCCCGGGAGGCGGACGTCTCGCGCGTCGCGCTCCGGCGCTTCCGCTTGGCCGACCCTTCCGGGCGTACCGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCCCGCCGTCCCGGAGACGGAGACCGCGCGGGCGGTTCGTCGTCTTCAGTATGTCTAWACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACTCGTCGCCCCCAACACCGTGCATGATATCGTGCCGGTTGTCGGAGGGGCGGATATTGGCTTCCCGTGCTTCGGTGCGTCTAGCATAAATGCAAGTCCCTTGCGACGGACACGACGACAAGTGGTGGTTGATTTACTCAACTAAGGTGATGTCGGCGTTGCCCCGTTGGATGAGGAGACTTCCTTGACCCTAACGCATACGTCGTCAAGACGTCTGCCACGACCGCGACCCC

Click for details-----ITS1

TCGAAACCTGCATGGCAGAACGACCCGACAACACGTTCCGACGCTCGGGGGCGGGGGGTCTCGCGGCTCCTCGCCCCCACCTCCCGGGAGGCGGACGTCTCGCGCGTCGCTCCGGCCGTTCCGCTTGGCCGACCCTTCCGGGCGTACCGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCCCGCCGTCCCGGAGACGGAGACCGCGCGGGCGTTCGTCCGTCTTCAGTATGTCTAAA

Click for details-----ITS2

GTCGTTGCCCCCCTGACCCCTTCGGGGTCGGACGGGACGGATGATGGCCTTCCCGTGTGCCCCGTCACGCGGTTGGCATAAATACCGAGTCCTCGGCGACCGGCGGTCCGGCGATCGGTGGTTGTCAAACCTCGGTGCCTTGTCGCGTGCGTGAGTCGATCGCGGGACTTCCTTAGCCGTAAGCGCGTCGGTAACCCGACGTTTCAA
Taxonomic Information

Plant ID: NPO10339
Plant Latin Name: Fragaria X Ananassa
Taxonomy Genus: Fragaria
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 3747
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

182 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


111 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

127 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98121

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC89422

Ingredient ID: NPC88759

Ingredient ID: NPC86655

Ingredient ID: NPC85813

Ingredient ID: NPC85751

Ingredient ID: NPC85488

Ingredient ID: NPC85042

Ingredient ID: NPC8159

Ingredient ID: NPC81010

Ingredient ID: NPC78263

Ingredient ID: NPC77916

Ingredient ID: NPC75204

Ingredient ID: NPC68873

Ingredient ID: NPC68779

Ingredient ID: NPC64370

Ingredient ID: NPC63121

Ingredient ID: NPC62045

Ingredient ID: NPC60288

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58957

Ingredient ID: NPC58190

Ingredient ID: NPC55823

Ingredient ID: NPC55412

Ingredient ID: NPC5447

Ingredient ID: NPC50898

Ingredient ID: NPC49151

Ingredient ID: NPC491307

Ingredient ID: NPC491305

Ingredient ID: NPC491303

Ingredient ID: NPC491295

Ingredient ID: NPC491245

Ingredient ID: NPC491243

Ingredient ID: NPC491235

Ingredient ID: NPC491232

Ingredient ID: NPC491231

Ingredient ID: NPC491223

Ingredient ID: NPC491218

Ingredient ID: NPC490469

Ingredient ID: NPC490454

Ingredient ID: NPC490453

Ingredient ID: NPC490435

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490408

Ingredient ID: NPC490401

Ingredient ID: NPC490344

Ingredient ID: NPC490298

Ingredient ID: NPC490289

Ingredient ID: NPC490287

Ingredient ID: NPC490242

Ingredient ID: NPC489907

Ingredient ID: NPC489904

Ingredient ID: NPC489899

Ingredient ID: NPC489875

Ingredient ID: NPC48623

Ingredient ID: NPC482524

Ingredient ID: NPC482523

Ingredient ID: NPC46274

Ingredient ID: NPC424

Ingredient ID: NPC38779

Ingredient ID: NPC38497

Ingredient ID: NPC328447

Ingredient ID: NPC325345

Ingredient ID: NPC32441

Ingredient ID: NPC32368

Ingredient ID: NPC320263

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC305094

Ingredient ID: NPC299484

Ingredient ID: NPC29883

Ingredient ID: NPC296337

Ingredient ID: NPC29599

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294703

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC282298

Ingredient ID: NPC281686

Ingredient ID: NPC281131

Ingredient ID: NPC280580

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC278711

Ingredient ID: NPC278068

Ingredient ID: NPC277704

Ingredient ID: NPC272614

Ingredient ID: NPC2724

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC268342

Ingredient ID: NPC262505

Ingredient ID: NPC261080

Ingredient ID: NPC257582

Ingredient ID: NPC242580

Ingredient ID: NPC239406

Ingredient ID: NPC237812

Ingredient ID: NPC236202

Ingredient ID: NPC235260

Ingredient ID: NPC230468

Ingredient ID: NPC228346

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC225539

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC216361

Ingredient ID: NPC213876

Ingredient ID: NPC211453

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC206800

Ingredient ID: NPC203468

Ingredient ID: NPC202742

Ingredient ID: NPC199072

Ingredient ID: NPC194081

Ingredient ID: NPC19240

Ingredient ID: NPC190454

Ingredient ID: NPC190217

Ingredient ID: NPC189436

Ingredient ID: NPC189142

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC181153

Ingredient ID: NPC179950

Ingredient ID: NPC179831

Ingredient ID: NPC178306

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC175342

Ingredient ID: NPC174246

Ingredient ID: NPC173637

Ingredient ID: NPC171280

Ingredient ID: NPC170053

Ingredient ID: NPC169749

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC162304

Ingredient ID: NPC161571

Ingredient ID: NPC160512

Ingredient ID: NPC156654

Ingredient ID: NPC153572

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149209

Ingredient ID: NPC147983

Ingredient ID: NPC141986

Ingredient ID: NPC138010

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135695

Ingredient ID: NPC133671

Ingredient ID: NPC130683

Ingredient ID: NPC128350

Ingredient ID: NPC127624

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC126029

Ingredient ID: NPC11724

Ingredient ID: NPC116775

Ingredient ID: NPC11666

Ingredient ID: NPC115216

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC11150

Ingredient ID: NPC11119

Ingredient ID: NPC110107

Ingredient ID: NPC109813

Ingredient ID: NPC108811

Ingredient ID: NPC107111