• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Crotalaria Assamica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GTCGAAGCCTCGCAAGCAGTGCGACCCGTGGATTTGTTTGACATGTGAGGGATGGCTAGAGGTGTTCTCGTCCTCGGTCCCCCTCGTGTCGGGAGGCGCCATGCCTTGTGTGGTATCCTCTCGTTCGAATAACAAAAACCCGGCGCTGAATGCGCCAAGGAGATCGAAATCGTTTAGTGCACCCCCGTGGGCTCGGAGACGGTGCTTGTGCGGGCGGTGATGCGACACGCGTATCGAA

Click for details-----ITS2

ATTGTTGCCCCAGTTCCTTGGCCTCATGCTAGGCACCGAGCTGGGCGAATGCTGGCTTCCCGTGAGCAAAGCCTCCCGGTTGGTTGAAAATTGAGTCCGTGGTGGGTGGCACCGTGGCGGATGGTGGTTGAGTAAGAGAAAGCTTGAGACCCATCGTGGTTGTCACCCGCACCGGCATTTGG
Taxonomic Information

Plant ID: NPO10262
Plant Latin Name: Crotalaria Assamica
Taxonomy Genus: Crotalaria
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 671522
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; China

Traditional Medicine System:
TCM

Geographical Distribution

Thailand; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC87545

Ingredient ID: NPC50898

Ingredient ID: NPC476459

Ingredient ID: NPC473417

Ingredient ID: NPC40583

Ingredient ID: NPC37709

Ingredient ID: NPC323593

Ingredient ID: NPC309154

Ingredient ID: NPC235428

Ingredient ID: NPC134546

Ingredient ID: NPC109180