• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Castanopsis Eyrei


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACCGGTGACAACCGACGGGGGGCGGGGGGCGCCCGTCGCCCCCTCGCCCCCCCGCTGCGGGCGGGGACCTTGCGTCTCTCGCCCGCAAACCGAACCCCGGCGCGGAATGCGCCAAGGAAATCGAAAACAAAGAGAGCCACGCCGGAGGCCCCGGACACGGTGCGCCCCCGGCGTCGGCGCCTTACTAATTATCCAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCCCCAAACGCCAGTTCGGGGCGGGGCGGAAGCTGGCCTCCCGTGCGTGCCCGCGCGCGCGGTTAGCCCAAAAGCGAGTCCTCGGCGACGAGCGCCACGACAATCGGTGGTTTTTTGACCCTCGTTCCCCGTCGTGCGCGCCCCGTCGCCCGAACGCGCTCTCTAGACCCTTGCGCGTCGCCTCGGCGGCGCTCCCAACGCGACCCC

Click for details-----ITS1

TCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACCGGTGACAACCGACGGGGGGCGGGGGGCGCCCGTCGCCCCCTCGCCCCCCCGCTGCGGGCGGGGACCTTGCGTCTCTCGCCCGCAAACCGAACCCCGGCGCGGAATGCGCCAAGGAAATCGAAAACAAAGAGAGCCACGCCGGAGGCCCCGGACACGGTGCGCCCCCGGCGTCGGCGCCTTACTAATTATCCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO10235
Plant Latin Name: Castanopsis Eyrei
Taxonomy Genus: Castanopsis
Taxonomy Family: Fagaceae

Plant External Links:

NCBI TaxonomyDB: 425820
Plant-of-the-World-Online: 295389-1

Used in Medicines

Unknown.

Geographical Distribution

Taiwan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

23 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC76336

Ingredient ID: NPC50898

Ingredient ID: NPC305641

Ingredient ID: NPC298040

Ingredient ID: NPC297358

Ingredient ID: NPC281125

Ingredient ID: NPC264470

Ingredient ID: NPC261947

Ingredient ID: NPC261004

Ingredient ID: NPC255580

Ingredient ID: NPC25495

Ingredient ID: NPC253769

Ingredient ID: NPC247553

Ingredient ID: NPC240596

Ingredient ID: NPC22760

Ingredient ID: NPC223804

Ingredient ID: NPC181255

Ingredient ID: NPC168906

Ingredient ID: NPC163524

Ingredient ID: NPC137949

Ingredient ID: NPC122809

Ingredient ID: NPC117260

Ingredient ID: NPC103711