CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Juniperus Communis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CCGAATTGGGATCGAGACTGATCGTGTAGGGGACGGAGCTCGCCTCCCCTCCCCGCCCCCAAAATCTCAGGCGACGTGCGGACACTTGGCCTTGCAGCGATGTGCTGGACGGCCAAGCTAAAGGGTCCCGCGCCGTCGCGGTCGAGGGTCATCGAATGCCGCGATCGAAAGCGTGGATTCCCCGCGGTGCGAAGAGACTCGGGCGCAAAATCTGGATCGCAACTGGTGCCTTCGAACGACGTCTACGTCGGAGCGAGCGGTCCCTGCTCGGTTGTAGGTTCAGAGGACGTCCGGGCCTCATCCCCCGTTGAGATTTCATGGCTCGGTCGTGTGCGCGGCGCTGTGCCAGGGATCCGTCGATTCGTCGGCGGCAAGTCGGGACTGCCGCAACCCCCCGTTGCGTTTGCTCAGGTGTTAATTGGCCGCTGGGAGCGTTCTGTGTTCAGGATGGGTGCACTCGCATGATCTGCGTGGCAGGGGCCCCCGTCCGACGGCACGACTCTCCCTTGCGGCGACTCCCACCTTTGCGAGGTGACGGGGCGGGGACACACCACAGCGTTCTTCGTCGCACCCCTCGGGTGTGCTCGGAGGGCGGGATGTGTCAACACCCAACACACGGGTGCGCATCGCGCACCTTAGAAATCCAAAAGAAATGAAGTGCGATCCAGCGCCTTGTGCGCTTGGGTCGGACGAAAGAGGAAAAAACATAACGAAATCACGACTCTCGGCAACGGATATCTCGGCTCTCGCCACGATGAAGAATGTAGCGAAATGCGATACTTAGTGTGAATTGCAGAATCCCGTGAATCATCAAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCAAGGGCACGTCTGCTTGGGCGTCGCACTCCAAAACTGCCCTCCCCCGCGAGGAGCGTAGATGGCCGTCCGTGTCCGCAAGTGGGGCGGTCGGCTGAAATGAGCACGAGGTCCGTCGATCCGTCGCGACCAGCGGTGGTTCCCAAAGGCCGGCGTTTGTTTTTGGCTGATCCAACCAATCCTTCCCGTGGGAAATTTATTTTTTGTGGCCCCGGCCCCCCCAAAAGGGGGGCTTGGTGGGTTTTCTCCCCGGTCCCCCAAATAAGGGGGGGAAAACACCCCCAATTTATCAATAAATATTATTAAAGGGAGAAGGAGAAGAAGAAAAACTTTTTTCCTTTCTTCTCTTTTTTCTTCTTGTATCTATCTCTTCTATCTTCTTTTATATATTGTTATATATCTGTATGTTTATATTTATATTTTT

Click for details-----ITS1

GGGAATTTCCCCCTAAGACCTGCATCGTGTAGGGGACGGAGCTCGCCTCCCCTCCCCGCCCCCAAAATCTCGGCGACGTGCGGACACTTGGCCTTGCAGCGATGTGCTGGACGGCCAAGCTAAAGGGTCCCGCGCCGTCGCGGTCGAGGGTCATCGAATGCCGCGATCGAAAGCGTGGATTCCCCGCGGTGCGAAGAGACTCGGGCGCAAAATCTGGATCGCAACTGGTGCCTTCGAACGACGTCTACGTCGGAGCGAGCGGTCCCTGCTCGGTTGTAGGTTCAGAGGACGTCCGGGCCTCATCCCCCGTTGAGATTTCATGGCTCGGTCGTGTGCGCGGCGCTGTGCCAGGGATCCGTCGATTCGTCGGCGGCAAGTCGGGACTGCCGCAACCCCCCGTTGCGTTTGCTCAGGTGTTAATTGGCCGCTGGGAGCGTTCTGTGTTCAGGATGGGTGCACTCGCATGATCTGCGTGGCAGGGGCCCCCGTCCGACGGCACGACTCTCCCTTGCGGCGACTCCCACCTTTGCGAGGTGACGGGGCGGGGACACACCACAGCGTTCTTCGTCGCACCCCTCGGGTGTGCTCGGAGGGCGGGATGTGTCAACACCCAACACACGGGTGCGCATCGCGCACCTTAGAAATCCAAAAGAAATGAAGTGCGATCCAGCGCCTTGTGCGCTTGGGTCGGACGAAAGAGGAAAAAACATAACGAAATCA

Click for details-----ITS2

TCCAAAACTGCCCTCCCCCGCGAGGAGCGTAGATGGCCGTCCGTGTCCGCAAGTGGGGCGGTCGGCTGAAATGAGCACGAGGTCCGTCGATCCGTCGCGACCAGCGGTGGTTCCCAAAGGCCGGCGTTTGTTTTTGGCTGATCCAACCAATCCTTCCCGTGGGAAATTTATTTTTTGTGGCCCCGGCCCCCCCAAAAGGGGGGCTTGGTGGGTTTTCTCCCCGGTCCCCCAAATAAGGGGGGGAAAACACCCCCAATTTATCAATAAATATTATTAAAGGGAGAAGGAGAAGAAGAAAAACTTTTTTCCTTTCTTCTCTTTTTTCTTCTTGTATCTATCTCTTCTATCTTCTTTTATATATTGTTATATATCTGTATGTTTATATTTATATTTTT

Taxonomic Information

Plant ID: NPO10219
Plant Latin Name: Juniperus Communis
Taxonomy Genus: Juniperus
Taxonomy Family: Cupressaceae

Plant External Links:

NCBI TaxonomyDB: 58039
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Albania; Italy; Finland; India; Sweden; Spain

Traditional Medicine System:

Medicinal Functions:

Antiseptic; Aromatherapy; Aromatic; Carminative; Diaphoretic; Diuretic; Rubefacient; Stomachic; Tonic

Geographical Distribution

Albania; Italy; Finland; India; Sweden; Spain

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

26 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

19 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC85248

Ingredient ID: NPC80427

Ingredient ID: NPC80230

Ingredient ID: NPC75204

Ingredient ID: NPC63786

Ingredient ID: NPC60911

Ingredient ID: NPC4817

Ingredient ID: NPC32222

Ingredient ID: NPC310862

Ingredient ID: NPC305327

Ingredient ID: NPC279508

Ingredient ID: NPC279121

Ingredient ID: NPC265784

Ingredient ID: NPC250323

Ingredient ID: NPC240009

Ingredient ID: NPC219573

Ingredient ID: NPC208729

Ingredient ID: NPC20791

Ingredient ID: NPC202189

Ingredient ID: NPC196941

Ingredient ID: NPC190810

Ingredient ID: NPC167571

Ingredient ID: NPC138113

Ingredient ID: NPC122318

Ingredient ID: NPC119969

Ingredient ID: NPC116839

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Metallo protease	MMP12	Matrix metalloproteinase 12	P39900	CHEMBL4393
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Peptide receptor (family A GPCR)	NPSR1	Neuropeptide S receptor	Q6W5P4	CHEMBL5162
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	YES1	Tyrosine-protein kinase YES	P07947	CHEMBL2073
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Protein Kinase	MKNK1	MAP kinase-interacting serine/threonine-protein kinase MNK1	Q9BUB5	CHEMBL4718
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	AXL	Tyrosine-protein kinase receptor UFO	P30530	CHEMBL4895
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	22

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04851821	The Effectiveness of Phytotherapy in SARS-COV2(COVID-19)	COVID-19	Quercetin (NPC20791)	NP level
NCT03943459	Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease	coronary artery disease	Quercetin (NPC20791)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level
NCT05062486	A Study to Evaluate the Safety and Efficacy of RQC for AMD	age-related macular degeneration	Quercetin (NPC20791)	NP level
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT04907253	Quercetin in Coronary Artery By-pass Surgery	coronary artery disease	Quercetin (NPC20791)	NP level
NCT04946383	Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging	aging	Quercetin (NPC20791)	NP level
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT05422885	Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease	aging	Quercetin (NPC20791)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Quercetin (NPC20791)	NP level
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT02848131	Senescence in Chronic Kidney Disease	chronic kidney disease	Quercetin (NPC20791)	NP level
NCT03989271	Biological Effects of Quercetin in COPD	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Quercetin (NPC20791)	NP level
NCT04853199	Quercetin In The Treatment Of SARS-COV 2	COVID-19	Quercetin (NPC20791)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT05456022	Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line	mouth neoplasm	Quercetin (NPC20791)	NP level
NCT05432284	Behavioral Pharmacology of THC and Beta-Myrcene	cannabis dependence	Myrcene (NPC138113)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDK1,IGF1R,KDR,MMP12,AXL,ALOX5,EGFR,FLT3,MET
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	MMP12,ALOX5,CYP1B1,NOX4,CA12,DPP4,MET,XDH,CA7
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	IGF1R,EGFR,MET,MKNK2,FLT3,MKNK1,KDR,TP53
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MMP12,NPSR1,AURKB,NOX4,CYP19A1,MET,CDK1,ALOX15
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ALOX5,AURKB,CYP19A1,MET,XDH,MMP12,ALOX5,AURKB
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	MMP12,CA7,NPSR1,AURKB,CA12,ALOX12,CDK1,XDH
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MKNK1,MKNK2,KDR,MET,CSNK2A1,IGF1R,EGFR
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TP53,AURKB,GSK3B,SRC,AXL,FLT3,PIM1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	MMP12,CA7,NPSR1,AURKB,CA12,CDK1,XDH
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,MMP12,NPSR1,AURKB,CDK1,XDH,ALOX15
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HSD17B10,MMP12,CYP1B1,AKR1B1,DPP4,FLT3,ALOX15
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,CYP1B1,CYP19A1,CA12,DPP4,MET,KDR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A,MET,TP53,KDR,EGFR,SRC
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	FLT3,AURKB,CDK1,TP53,DPP4,SRC
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	MMP12,NPSR1,AURKB,NOX4,CDK1,ALOX15
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	SRC,IGF1R,KDR,AXL,FLT3
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,MET,FLT3,KDR,TP53
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	MMP12,NOX4,MET,CA4,XDH
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	MMP12,AKR1B1,NOX4,DPP4,FLT3
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1,MMP12,NPSR1,NOX4,MET
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	MMP12,AURKB,CA12,CDK1,XDH
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	HIF1A,AXL,CYP19A1,EGFR,XDH
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,AURKB,CA12,MET,CYP1A2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	HIF1A,MKNK1,MKNK2,EGFR
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR,AXL,TP53,SRC
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	FLT3,ALOX5,DPP4 MMP12
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,EGFR,KDR,TP53
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TP53,KDR,AXL,EGFR
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	KDR,DPP4,AKR1B1,AURKB
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	EGFR,KDR,MET,TP53
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TP53,IGF1R,SRC,EGFR
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,TP53,FLT3,KDR
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	EGFR,KDR,MET,MMP12
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	MMP12,NPSR1,AURKB,NOX4
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4,MET,CYP19A1,AXL
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CDK1,AKR1B1,CYP1A2,AURKB
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	MMP12,AURKB,CA12,CDK1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,CA4,MET
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MET,KDR,FLT3
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	EGFR,KDR,MET
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R,XDH NCT02848131
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,EGFR,KDR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	SRC,MET,KDR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1,ALOX5,IGF1R
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	MET,SRC,KDR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,SRC,GSK3B
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,MET,TP53
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	ALOX5,CA4,MMP12
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	ALOX5,CDK1,EGFR
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	EGFR,KDR,FLT3
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,MET,EGFR
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ABCG2,AKR1B1,ALOX5
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,ALOX15 NCT01912820
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R,ABCG2,NOX4
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4,SRC,CA4
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	MET,FLT3,AXL
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,NOX4,DPP4
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA12,SRC,EGFR,FLT3,CDK1,GSK3B,CSNK2A1,XDH,AXL,KDR,MET,YES1,PIM1,TP53,MKNK2,IGF1R,CA4,AURKB,ALOX5,HIF1A,POLB,MKNK1
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1,AKR1B1
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	GSK3B,SRC
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5,XDH
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CA4
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	ALOX5,KDR
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	MET,EGFR
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R,ALOX5
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12,CA4
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC,TP53
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC,TP53
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC,ALOX5
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FLT3,ALOX5
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4 NCT01839344
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,MET
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC,TP53
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	KDR,SRC
NA Disease Category: NA Disease ICD-11 Code: NA	MET,NOX4
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC,GSK3B
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3,CDK1
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	IGF1R,SRC
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	SRC,FLT3
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT01708278,NCT03989271
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04853199,NCT04851821
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT03943459,NCT04907253
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT05422885,NCT04946383
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1,CDK1
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	MMP12,NOX4
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CDK1,CA12
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	AURKB,ABCG2
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	ABCG2,CA4
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	MMP12,DPP4
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP1A1,ALOX15
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MMP12,CYP1A1
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1,YES1
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1,ABCG2
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET,AXL
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	MMP12,NOX4
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	KDR,ALOX5,CSNK2A2,FLT3,CA7,ALOX15,MMP12,PIM1,RECQL,CA12,DPP4,EGFR,SRC,AXL,AURKB,MET,CDK1,XDH
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	POLB,HIF1A,ABCG2,ALOX5,CYP1B1,NPSR1,PIM1,RECQL,AXL,AURKB,DPP4,MET,XDH,CA7,ALOX15
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HSD17B10,POLB,MMP12,AKR1B1,NPSR1,AURKB,CYP19A1,DPP4,YES1,MET,TP53,XDH,CA7,ALOX15
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	HSD17B10,CSNK2A2,NOX4,RECQL,CA12,EGFR,CDK1,SRC,AKR1B1,AXL,AURKB,MET,TP53,KDR
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	KDR,HIF1A,ABCG2,ALOX5,AKR1B1,NPSR1,NOX4,CA12,DPP4,ALOX12,MET,CA4,CDK1,XDH
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	IGF1R,HIF1A,CSNK2A3,CDK1,MMP12,ALOX5,SRC,AKR1B1,AURKB,NOX4,ALOX12,CA4,TP53
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	MMP12,AURKB,NOX4,CYP19A1,CA12,CA4,CDK1,MMP12,SRC,AURKB,CYP19A1,CA12,CDK1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	MKNK1,EGFR,SRC,IGF1R,CYP19A1,KDR,MET,MKNK2,CA12,CA4,AXL,CDK1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,MMP12,ALOX5,NOX4,CA12,ALOX12,YES1,MET,TP53,XDH,CYP1A2,ALOX15
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	IGF1R,MMP12,SRC,AKR1B1,AURKB,NOX4,CYP19A1,CA12,CA4,CDK1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	MMP12,AURKB,NOX4,CYP19A1,CA12,DPP4,MET,CA4,CDK1,CA7
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	SRC
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	ALOX5
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	AXL
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	ABCG2
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Malignant neoplasms of other or unspecified parts of mouth Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B66	NCT05456022
Cannabis use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C41	NCT05432284
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT05276895
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT01438320
Congenital aplastic anaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A70.0	NCT01720147
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	NCT02226484
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT05062486
Lichen planus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA91	NCT01375101
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT01348204
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP12
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	PIM1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	AXL
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	MMP12
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	MMP12
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Juniperus Communis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

26 All known Ingredients in Total

19 Ingredients with Acceptable Bioavailablity

12 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Lung cancer

Malignant neoplasms of thyroid gland, unspecified

Colorectal cancer

Adenocarcinoma of stomach

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Liver cancer

Acute myeloid leukaemia

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Glioblastoma of brain

Brain cancer

Malignant haematopoietic neoplasm

Malignant neoplasms of oesophagus

Multiple myeloma

Ovarian cancer

Pheochromocytoma

Leishmaniasis

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Chikungunya virus disease

Renal cell carcinoma, chromophobe type

Mature T-cell lymphoma

Mature B-cell leukaemia

Psoriasis

Head and neck cancer

Myelodysplastic syndrome

Acute diabete complication

Stomach cancer

Pancreatic cancer

Peritoneal cancer

Renal cell carcinoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

West Nile virus infection

Urothelial carcinoma of bladder

Invasive carcinoma of breast

Glaucoma

Alzheimer disease

Melanoma

Chronic kidney disease

Metastatic lymph node neoplasm

Pleomorphic sarcoma

Pain, unspecified

Cardiovascular disease

Myeloproliferative neoplasm

Chronic arterial occlusive disease

Asthma

Nasopharyngeal cancer

Chronic pain

Non-small cell lung cancer

Rheumatoid arthritis

Adenocarcinoma of prostate

Melanoma of skin

Superficial ovarian endometriosis

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Carpal tunnel syndrome

Solid tumour/cancer

Gastrointestinal stromal tumour

Neuropathy

Parkinsonism