• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Euphorbia Antiquorum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCGGAAGGATCATTGTCGAAGCCTGCCCAACAGAATGACCCGTGAACATGTTTATAAATCGATGGGCTGCTGTAGGATTTATCCAGCATAAGCACGTCATTAGGGAGCGAGCAGGGGATGCGAGTGCTGGCATTTGCCTTGCCCTCGTGATGTCCTGTTCGCTGCCTGCTAACCAAACCCCGACGCTGTACGCGTCAAGGAACTGTAATCAAAAAAGTTTGCACGCCCCTAGCACACTGGAAACGGTGTGCACACAGGATGCGTTGCACTGTGTTAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCAACTGTCGCTCTAGCCCCTTCCAATTGGAAGGGGCATGCAGGGCGGATGTTGGCCTCCCGTGTGCTCTTTGCTTCCGGTTGGCCCAAATGTCTGGTCTCGGGCAACATTGCCACAGAAATCGGTGGTTGTAAAGCACTCACAAAAATCTGTGCGCAATCGAAAGCCCATTCAGACCAATGAGACCCTAAAAAGTACCTACACA

Click for details-----ITS1

TGCGGAAGGATCATTGTCGAAGCCTGCCCAACAGAATGACCCGTGAACATGTTTATAAATCGATGGGCTGCTGTAGGATTTATCCAGCATAAGCACGTCATTAGGGAGCGAGCAGGGGATGCGAGTGCTGGCATTTGCCTTGCCCTCGTGATGTCCTGTTCGCTGCCTGCTAACCAAACCCCGACGCTGTACGCGTCAAGGAACTGTAATCAAAAAAGTTTGCACGCCCCTAGCACACTGGAAACGGTGTGCACACAGGATGCGTTGCACTGTGTTAACAAAAA

Click for details-----ITS2

CAACTGTCGCTCTAGCCCCTTCCAATTGGAAGGGGCATGCAGGGCGGATGTTGGCCTCCCGTGTGCTCTTTGCTTCCGGTTGGCCCAAATGTCTGGTCTCGGGCAACATTGCCACAGAAATCGGTGGTTGTAAAGCACTCACAAAAATCTGTGCGCAATCGAAAGCCCATTCAGACCAATGAGACCCTAAAAAGTACCTACACA
Taxonomic Information

Plant ID: NPO10031
Plant Latin Name: Euphorbia Antiquorum
Taxonomy Genus: Euphorbia
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: 334664
Plant-of-the-World-Online: 345613-1

Used in Medicines

Country/Region:
Indonesia; India; Malaysia; Vietnam; China; Laos; Thailand

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Pakistan; Bangladesh; Myanmar; Indonesia; India; Malaysia; Vietnam; China; Laos; Sri Lanka; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

117 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


44 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

70 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96257

Ingredient ID: NPC88811

Ingredient ID: NPC88686

Ingredient ID: NPC886

Ingredient ID: NPC88218

Ingredient ID: NPC83963

Ingredient ID: NPC836

Ingredient ID: NPC81761

Ingredient ID: NPC81630

Ingredient ID: NPC81211

Ingredient ID: NPC78363

Ingredient ID: NPC77217

Ingredient ID: NPC75556

Ingredient ID: NPC72615

Ingredient ID: NPC66090

Ingredient ID: NPC64160

Ingredient ID: NPC64141

Ingredient ID: NPC55666

Ingredient ID: NPC54733

Ingredient ID: NPC51700

Ingredient ID: NPC482195

Ingredient ID: NPC482194

Ingredient ID: NPC482193

Ingredient ID: NPC482192

Ingredient ID: NPC482191

Ingredient ID: NPC482190

Ingredient ID: NPC482189

Ingredient ID: NPC482188

Ingredient ID: NPC482187

Ingredient ID: NPC482186

Ingredient ID: NPC482185

Ingredient ID: NPC482184

Ingredient ID: NPC482183

Ingredient ID: NPC482182

Ingredient ID: NPC482181

Ingredient ID: NPC482180

Ingredient ID: NPC482179

Ingredient ID: NPC482178

Ingredient ID: NPC482177

Ingredient ID: NPC482176

Ingredient ID: NPC482175

Ingredient ID: NPC482174

Ingredient ID: NPC479249

Ingredient ID: NPC479248

Ingredient ID: NPC479247

Ingredient ID: NPC479246

Ingredient ID: NPC479245

Ingredient ID: NPC479244

Ingredient ID: NPC479243

Ingredient ID: NPC479242

Ingredient ID: NPC479241

Ingredient ID: NPC479240

Ingredient ID: NPC479239

Ingredient ID: NPC479238

Ingredient ID: NPC479237

Ingredient ID: NPC47182

Ingredient ID: NPC46160

Ingredient ID: NPC45960

Ingredient ID: NPC45844

Ingredient ID: NPC45360

Ingredient ID: NPC39322

Ingredient ID: NPC38136

Ingredient ID: NPC36986

Ingredient ID: NPC35880

Ingredient ID: NPC34927

Ingredient ID: NPC307583

Ingredient ID: NPC301802

Ingredient ID: NPC29883

Ingredient ID: NPC290791

Ingredient ID: NPC290367

Ingredient ID: NPC287597

Ingredient ID: NPC282779

Ingredient ID: NPC272004

Ingredient ID: NPC270215

Ingredient ID: NPC269648

Ingredient ID: NPC262727

Ingredient ID: NPC26229

Ingredient ID: NPC26065

Ingredient ID: NPC258477

Ingredient ID: NPC255195

Ingredient ID: NPC251616

Ingredient ID: NPC240604

Ingredient ID: NPC232486

Ingredient ID: NPC230301

Ingredient ID: NPC224651

Ingredient ID: NPC216110

Ingredient ID: NPC214770

Ingredient ID: NPC213561

Ingredient ID: NPC205455

Ingredient ID: NPC202498

Ingredient ID: NPC197316

Ingredient ID: NPC189556

Ingredient ID: NPC18722

Ingredient ID: NPC183459

Ingredient ID: NPC18335

Ingredient ID: NPC170416

Ingredient ID: NPC170364

Ingredient ID: NPC16345

Ingredient ID: NPC160209

Ingredient ID: NPC159981

Ingredient ID: NPC146792

Ingredient ID: NPC14490

Ingredient ID: NPC141014

Ingredient ID: NPC139156

Ingredient ID: NPC138899

Ingredient ID: NPC136699

Ingredient ID: NPC130683

Ingredient ID: NPC130444

Ingredient ID: NPC127639

Ingredient ID: NPC118508

Ingredient ID: NPC117764

Ingredient ID: NPC113733

Ingredient ID: NPC113416

Ingredient ID: NPC111888

Ingredient ID: NPC105025

Ingredient ID: NPC100998

Ingredient ID: NPC100334