• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Prunus Dulcis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTTTCCGTAGGTGAACCTGGGGAAAGATCCTTTTTGGAACCTGCCTAGCCGAACGACCCGAGAACTAGTTTCAAAGCGGGGGCCGAGGGGTCCTGCGGCTCCTCGTCCCCTTTATCTCGGGGGGGTTGCGTTGCGCTCGCGCCGACCCTTCCGGGCGTACAAACGAACACCGGCGCGAATTGCGAAGGAAATTGAACGAGAGAGCGCGTCCCCGTCGCCCCGGAAACGGTGTGCGAGGGCGGCGTCGTCATCTTCAAATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCATCAACTCCTTCGGGATTGCGGGGGGCGGATGATGGCCTCCCGTGCGCCTCGCCGCGCGTTGGCATAAATACCAAGTCCTCGGCGACGCACGCCACGACAATCGGTGGTTGCGAGACCTCGGTTGCCCGTCGTGTGCGTTCGTCGCGCATCGAGGGCTCGAAAAAATGCTCGGCTCCGGCTCGGCTTTCAACGCGACCCCAGGTCAGCG

Click for details-----ITS1

GTTTCCGTAGGTGAACCTGGGGAAAGATCCTTTTTGGAACCTGCCTAGCAGAACGACCCGAGAACTAGTTTCAAAGCGGGGGCCGAGGGGTCCTGCGGCTCCTCGTCCCCTTTATCTCGGGGGGGTTGCGTTGCGCTCGCGCGGCCGACCCTTCCGGGCGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAAATTGAACGAGAGAGCGCGTCCCCGTCGCCCCGGAAACGGTGTGCGAGGGCGGCGTCGTCATCTTCAAATATGTCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO10029
Plant Latin Name: Prunus Dulcis
Taxonomy Genus: Prunus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 3755
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India; Italy

Traditional Medicine System:
Unani; Indian Folk; Homeopathy; Ayurveda; Siddha


Medicinal Functions:

Antiemetic; Antitumor; Demulcent; Emollient; Miscellany; Nutritive; Pectoral

Geographical Distribution

Italy; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

125 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


78 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

99 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC83032

Ingredient ID: NPC79943

Ingredient ID: NPC78500

Ingredient ID: NPC78263

Ingredient ID: NPC68779

Ingredient ID: NPC65678

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC55412

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489910

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC44659

Ingredient ID: NPC424

Ingredient ID: NPC40511

Ingredient ID: NPC39426

Ingredient ID: NPC36061

Ingredient ID: NPC34089

Ingredient ID: NPC330817

Ingredient ID: NPC328447

Ingredient ID: NPC32817

Ingredient ID: NPC32441

Ingredient ID: NPC31714

Ingredient ID: NPC317120

Ingredient ID: NPC314434

Ingredient ID: NPC313955

Ingredient ID: NPC309330

Ingredient ID: NPC30506

Ingredient ID: NPC301585

Ingredient ID: NPC29883

Ingredient ID: NPC295644

Ingredient ID: NPC294852

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC281686

Ingredient ID: NPC281131

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC265885

Ingredient ID: NPC265319

Ingredient ID: NPC26484

Ingredient ID: NPC261831

Ingredient ID: NPC260491

Ingredient ID: NPC257582

Ingredient ID: NPC251354

Ingredient ID: NPC246558

Ingredient ID: NPC246534

Ingredient ID: NPC243319

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC226453

Ingredient ID: NPC226340

Ingredient ID: NPC226027

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC216630

Ingredient ID: NPC213876

Ingredient ID: NPC209970

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC20535

Ingredient ID: NPC203468

Ingredient ID: NPC203050

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC196745

Ingredient ID: NPC189436

Ingredient ID: NPC188428

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC174246

Ingredient ID: NPC174020

Ingredient ID: NPC171736

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC163099

Ingredient ID: NPC163076

Ingredient ID: NPC162806

Ingredient ID: NPC162742

Ingredient ID: NPC156654

Ingredient ID: NPC15566

Ingredient ID: NPC155263

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135602

Ingredient ID: NPC133671

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC125062

Ingredient ID: NPC120649

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC111132

Ingredient ID: NPC104983

Ingredient ID: NPC104316