• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Nerium Oleander


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAATCCTACAGAGCGAACGACCCGCGAACTCGTTTATCCACGGGCGTCGGGCGCGGGGTCCTGCCCCCGCCCGTCTCCCCTGGCCGTCCGGTGCCTGCCGGCTCCCGGTCGTGCCGAATAACAAAAAAACCGGCGCGGAAAGCGCCAAGGACTATGAAACGGAATGCCTTCCAGCGGCTCGCCCGTTCGCGGAGCGGGCCGTAGGAAAAAAGGCGCCAGTCGAATCTAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCACGCCTCGCCCCGAACGGGACGAGGGTCGTGCGTGAGGGCGGAAAATGGCCTCCCGTGCTCCGTTGCGGCCGGCCTAAACCCGAGTCCCTCGCTGCGGACGTCACGACGAGTGGTGGTTGAAACACTCAACTCGAATGCGAGTCGTGCGCACCCGTGGCCGGGGATACCGTTAGACCCTACGGCGAGCCCCTCCCGAGGGGCGCTCGCCACGACCGCGACCCCAGGTCAGGCGGGGCTACC

Click for details-----ITS1

AGGTGAACCTGCGGAAGGATCATTGTCGAATCCTACAGAGCGAACGACCAGCGAACTCGTTTATCCTCGGGCGTCGGGCGCCGGGGTCTTGCCCCCGCCCGTCTCCCCTGGCCGGTCGGTGCCTGTCGGCTCCCGGTCGTGCCGAATAACAAAAAAACCGGCGCGGAAAGCGCCAAGGACTATGAAACGGAATGCCTTCCAGCGGCTCGCCCGTTCGCGGAGCGGGTCGAGGGAAAAAAGGCGCCAGTCGAATCTAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCCACGCCTCGCCCCGAACGGGACGAGGGTCGTGCGTGAGGGCGGAAAATGGCCTCCCGTGCTCCGTTGCGGCCGGCCTAAACCCGAGTCCCTCGCTGCGGACGTCACGACGAGTGGTGGTTGAAACACTCAACTCGAATGCGAGTCGTGCGCACCCGTGGCCGGGGATACCGTTAGACCCTACGGCGAGCCCCTCCCGAGGGGCGCTCGCCACGACCGCGACCCCAGGTCAGGCGGGGCTACC
Taxonomic Information

Plant ID: NPO10021
Plant Latin Name: Nerium Oleander
Taxonomy Genus: Nerium
Taxonomy Family: Apocynaceae

Plant External Links:

NCBI TaxonomyDB: 63479
Plant-of-the-World-Online: 80460-1

Used in Medicines

Country/Region:
Thailand; Philippines; Indonesia; India; China

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Cancer; Cardiotonic; Diaphoretic; Diuretic; Emetic; Expectorant; Parasiticide; Resolvent; Skin; Sternutatory

Geographical Distribution

Brazil; Afghanistan; Madagascar; Italy; Bangladesh; Nepal; Costa Rica; France; Ethiopia; Trinidad and Tobago; Cameroon; Australia; Iran; Algeria; El Salvador; Turkey; United States; Guatemala; Zimbabwe; China; Oman; Thailand; Belize; Spain; Eritrea; Libya; Iraq; Philippines; Indonesia; Portugal; Morocco; Kenya; New Zealand; Pakistan; Albania; Honduras; Myanmar; Chad; Mexico; Tunisia; Nicaragua; South Africa; India; Senegal; Greece; Japan; Niger; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

243 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


110 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

87 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99080

Ingredient ID: NPC9794

Ingredient ID: NPC96300

Ingredient ID: NPC96294

Ingredient ID: NPC95594

Ingredient ID: NPC93105

Ingredient ID: NPC92155

Ingredient ID: NPC91601

Ingredient ID: NPC91387

Ingredient ID: NPC90399

Ingredient ID: NPC89870

Ingredient ID: NPC86931

Ingredient ID: NPC85813

Ingredient ID: NPC85661

Ingredient ID: NPC85051

Ingredient ID: NPC81423

Ingredient ID: NPC80902

Ingredient ID: NPC7979

Ingredient ID: NPC76362

Ingredient ID: NPC75621

Ingredient ID: NPC75011

Ingredient ID: NPC74840

Ingredient ID: NPC74221

Ingredient ID: NPC73624

Ingredient ID: NPC73216

Ingredient ID: NPC69576

Ingredient ID: NPC67332

Ingredient ID: NPC67125

Ingredient ID: NPC66577

Ingredient ID: NPC66403

Ingredient ID: NPC66050

Ingredient ID: NPC65873

Ingredient ID: NPC63048

Ingredient ID: NPC60635

Ingredient ID: NPC60427

Ingredient ID: NPC5883

Ingredient ID: NPC58045

Ingredient ID: NPC57456

Ingredient ID: NPC56932

Ingredient ID: NPC54025

Ingredient ID: NPC52005

Ingredient ID: NPC52001

Ingredient ID: NPC51700

Ingredient ID: NPC4949

Ingredient ID: NPC49389

Ingredient ID: NPC49254

Ingredient ID: NPC49151

Ingredient ID: NPC484202

Ingredient ID: NPC477580

Ingredient ID: NPC477579

Ingredient ID: NPC477578

Ingredient ID: NPC477577

Ingredient ID: NPC476071

Ingredient ID: NPC46575

Ingredient ID: NPC44899

Ingredient ID: NPC43728

Ingredient ID: NPC43116

Ingredient ID: NPC42793

Ingredient ID: NPC40552

Ingredient ID: NPC40394

Ingredient ID: NPC3946

Ingredient ID: NPC38044

Ingredient ID: NPC36933

Ingredient ID: NPC36337

Ingredient ID: NPC33233

Ingredient ID: NPC31354

Ingredient ID: NPC31171

Ingredient ID: NPC311248

Ingredient ID: NPC308429

Ingredient ID: NPC306682

Ingredient ID: NPC304542

Ingredient ID: NPC304481

Ingredient ID: NPC304260

Ingredient ID: NPC301263

Ingredient ID: NPC296742

Ingredient ID: NPC29639

Ingredient ID: NPC295777

Ingredient ID: NPC295110

Ingredient ID: NPC291379

Ingredient ID: NPC291158

Ingredient ID: NPC290693

Ingredient ID: NPC290481

Ingredient ID: NPC289501

Ingredient ID: NPC289445

Ingredient ID: NPC28893

Ingredient ID: NPC288816

Ingredient ID: NPC287331

Ingredient ID: NPC287231

Ingredient ID: NPC284764

Ingredient ID: NPC284536

Ingredient ID: NPC282764

Ingredient ID: NPC282368

Ingredient ID: NPC282252

Ingredient ID: NPC281131

Ingredient ID: NPC280245

Ingredient ID: NPC278990

Ingredient ID: NPC277673

Ingredient ID: NPC27765

Ingredient ID: NPC277628

Ingredient ID: NPC277336

Ingredient ID: NPC274330

Ingredient ID: NPC273920

Ingredient ID: NPC271027

Ingredient ID: NPC270426

Ingredient ID: NPC26938

Ingredient ID: NPC268326

Ingredient ID: NPC268164

Ingredient ID: NPC265800

Ingredient ID: NPC264317

Ingredient ID: NPC262505

Ingredient ID: NPC260731

Ingredient ID: NPC260145

Ingredient ID: NPC259960

Ingredient ID: NPC254713

Ingredient ID: NPC253568

Ingredient ID: NPC251428

Ingredient ID: NPC2509

Ingredient ID: NPC250539

Ingredient ID: NPC248729

Ingredient ID: NPC247365

Ingredient ID: NPC246708

Ingredient ID: NPC245229

Ingredient ID: NPC245029

Ingredient ID: NPC244513

Ingredient ID: NPC24100

Ingredient ID: NPC239860

Ingredient ID: NPC23858

Ingredient ID: NPC238023

Ingredient ID: NPC235842

Ingredient ID: NPC23518

Ingredient ID: NPC235023

Ingredient ID: NPC234239

Ingredient ID: NPC233533

Ingredient ID: NPC232078

Ingredient ID: NPC231738

Ingredient ID: NPC231518

Ingredient ID: NPC230301

Ingredient ID: NPC228624

Ingredient ID: NPC227900

Ingredient ID: NPC226426

Ingredient ID: NPC225163

Ingredient ID: NPC223865

Ingredient ID: NPC223360

Ingredient ID: NPC220735

Ingredient ID: NPC220217

Ingredient ID: NPC219998

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC216236

Ingredient ID: NPC215819

Ingredient ID: NPC215

Ingredient ID: NPC213449

Ingredient ID: NPC210640

Ingredient ID: NPC209357

Ingredient ID: NPC209124

Ingredient ID: NPC207689

Ingredient ID: NPC205258

Ingredient ID: NPC205182

Ingredient ID: NPC20505

Ingredient ID: NPC203050

Ingredient ID: NPC20281

Ingredient ID: NPC199772

Ingredient ID: NPC199428

Ingredient ID: NPC198664

Ingredient ID: NPC194758

Ingredient ID: NPC194638

Ingredient ID: NPC193578

Ingredient ID: NPC193041

Ingredient ID: NPC19114

Ingredient ID: NPC190986

Ingredient ID: NPC190810

Ingredient ID: NPC190244

Ingredient ID: NPC190120

Ingredient ID: NPC185529

Ingredient ID: NPC185290

Ingredient ID: NPC182463

Ingredient ID: NPC182415

Ingredient ID: NPC181465

Ingredient ID: NPC180941

Ingredient ID: NPC180587

Ingredient ID: NPC179986

Ingredient ID: NPC179544

Ingredient ID: NPC178383

Ingredient ID: NPC177022

Ingredient ID: NPC176740

Ingredient ID: NPC174098

Ingredient ID: NPC174052

Ingredient ID: NPC173816

Ingredient ID: NPC170456

Ingredient ID: NPC168870

Ingredient ID: NPC167072

Ingredient ID: NPC164336

Ingredient ID: NPC163982

Ingredient ID: NPC163771

Ingredient ID: NPC161097

Ingredient ID: NPC159845

Ingredient ID: NPC159543

Ingredient ID: NPC157555

Ingredient ID: NPC156348

Ingredient ID: NPC154374

Ingredient ID: NPC154245

Ingredient ID: NPC153085

Ingredient ID: NPC152615

Ingredient ID: NPC15257

Ingredient ID: NPC151719

Ingredient ID: NPC150777

Ingredient ID: NPC149375

Ingredient ID: NPC148291

Ingredient ID: NPC147905

Ingredient ID: NPC147754

Ingredient ID: NPC146172

Ingredient ID: NPC144658

Ingredient ID: NPC143797

Ingredient ID: NPC142415

Ingredient ID: NPC139929

Ingredient ID: NPC139413

Ingredient ID: NPC138925

Ingredient ID: NPC13789

Ingredient ID: NPC137096

Ingredient ID: NPC136548

Ingredient ID: NPC136133

Ingredient ID: NPC134826

Ingredient ID: NPC133792

Ingredient ID: NPC131108

Ingredient ID: NPC130306

Ingredient ID: NPC129913

Ingredient ID: NPC127549

Ingredient ID: NPC123710

Ingredient ID: NPC120098

Ingredient ID: NPC119855

Ingredient ID: NPC115721

Ingredient ID: NPC115349

Ingredient ID: NPC114069

Ingredient ID: NPC113733

Ingredient ID: NPC112630

Ingredient ID: NPC111216

Ingredient ID: NPC110041

Ingredient ID: NPC109954

Ingredient ID: NPC105730

Ingredient ID: NPC105339

Ingredient ID: NPC103534

Ingredient ID: NPC102063

Ingredient ID: NPC101839