• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Echium Pininana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCACCCCATCCACGACTACGTTGGATGGGGTGGATTCTGACCTCCTGTGCCTCCAGGCGTAGTTGGTCGAAATTCGAGTCCGGAGCTTAGGACCTCACGACAAGTGGTGGTTGGACAACAACTCGCGTCATGTCGTGTGCCGAAACTTTGTGCCTCTAAAGACCCTAAGGCGCGCGTTTCCCACACATTATATGTTGGGACGCTCGTGCTACGACCGC
Taxonomic Information

Plant ID: NPO10017
Plant Latin Name: Echium Pininana
Taxonomy Genus: Echium
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 113444
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


1 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC41296

Ingredient ID: NPC259364

Ingredient ID: NPC245789

Ingredient ID: NPC235260

Ingredient ID: NPC225710

Ingredient ID: NPC215412

Ingredient ID: NPC179950

Ingredient ID: NPC178134

Ingredient ID: NPC168579

Ingredient ID: NPC133671

Ingredient ID: NPC126029

Ingredient ID: NPC11666