• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Viburnum Davidii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCACACCCTGTGTCCCCAAAAGGGCACTGGGCGAGGGGCGGATATTGGCCTCCCGTGCTCCAGGGTGCGGTTGGCCCAAAAGCGAGTCCCCGGCAACGGACGTCACGACAAGTGGTGGTTGAAAAGCCCTCTTATCCTGTCGTGCGGTCCTCCGTTGCCATCGGGCGCTCCCTTGACCCTGATGCGCCGTTCCTGA
Taxonomic Information

Plant ID: NPO4892
Plant Latin Name: Viburnum Davidii
Taxonomy Genus: Viburnum
Taxonomy Family: Adoxaceae

Plant External Links:

NCBI TaxonomyDB: 237932
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

77 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


54 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99060

Ingredient ID: NPC96128

Ingredient ID: NPC95247

Ingredient ID: NPC86412

Ingredient ID: NPC82711

Ingredient ID: NPC81852

Ingredient ID: NPC81388

Ingredient ID: NPC78379

Ingredient ID: NPC74595

Ingredient ID: NPC74434

Ingredient ID: NPC71843

Ingredient ID: NPC68798

Ingredient ID: NPC68517

Ingredient ID: NPC66005

Ingredient ID: NPC62230

Ingredient ID: NPC61159

Ingredient ID: NPC58636

Ingredient ID: NPC47287

Ingredient ID: NPC38408

Ingredient ID: NPC35342

Ingredient ID: NPC32626

Ingredient ID: NPC311700

Ingredient ID: NPC307063

Ingredient ID: NPC302172

Ingredient ID: NPC291650

Ingredient ID: NPC287174

Ingredient ID: NPC27765

Ingredient ID: NPC274533

Ingredient ID: NPC268298

Ingredient ID: NPC264317

Ingredient ID: NPC262285

Ingredient ID: NPC261418

Ingredient ID: NPC259690

Ingredient ID: NPC250981

Ingredient ID: NPC250699

Ingredient ID: NPC249105

Ingredient ID: NPC243966

Ingredient ID: NPC243728

Ingredient ID: NPC237801

Ingredient ID: NPC237540

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC221751

Ingredient ID: NPC220007

Ingredient ID: NPC218250

Ingredient ID: NPC217052

Ingredient ID: NPC215055

Ingredient ID: NPC20428

Ingredient ID: NPC195305

Ingredient ID: NPC180114

Ingredient ID: NPC178383

Ingredient ID: NPC175955

Ingredient ID: NPC175236

Ingredient ID: NPC173471

Ingredient ID: NPC171125

Ingredient ID: NPC170847

Ingredient ID: NPC165287

Ingredient ID: NPC162817

Ingredient ID: NPC157193

Ingredient ID: NPC156947

Ingredient ID: NPC153813

Ingredient ID: NPC151981

Ingredient ID: NPC150427

Ingredient ID: NPC144075

Ingredient ID: NPC142415

Ingredient ID: NPC138489

Ingredient ID: NPC137949

Ingredient ID: NPC133017

Ingredient ID: NPC129795

Ingredient ID: NPC124011

Ingredient ID: NPC113733

Ingredient ID: NPC112236

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC106561

Ingredient ID: NPC104038

Ingredient ID: NPC103833

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Enzyme CES1 Acyl coenzyme A:cholesterol acyltransferase P23141 CHEMBL2265
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Phosphodiesterase TDP1 Tyrosyl-DNA phosphodiesterase 1 Q9NUW8 CHEMBL1075138
Therapeutic Target Protein Phosphatase CDC25B Dual specificity phosphatase Cdc25B P30305 CHEMBL4804
Therapeutic Target Surface antigen F3 Coagulation factor III P13726 CHEMBL4081
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Transcription factor TP53 Cellular tumor antigen p53 P04637 CHEMBL4096
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level99
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT02134353 A Safety and Efficacy Trial of Inhaled Mannitol in Adult Cystic Fibrosis Subjects cystic fibrosis Mannitol (NPC86412) NP level
NCT00630812 Long Term Administration of Inhaled Mannitol in Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT01796678 Arginine Therapy in Sickle Cell Disease-VOC Clinical Trial pain Arginine (NPC226453) NP level
NCT00047983 Omega-3 Fatty Acids That Affect the Immune System in Kidney Transplant Patients kidney disease Arginine (NPC226453) NP level
NCT03747679 Palatability (Taste) of Oral Formulations of Bosutinib chronic myelogenous leukemia Mannitol (NPC86412) NP level
NCT00147368 Arginine Malaria Trial: Study of Adjunctive Arginine in Falciparum Malaria Plasmodium falciparum malaria Arginine (NPC226453) NP level
NCT01388764 Safety, Tolerability and Effects of L-Arginine in Boys With Dystrophinopathy on Corticosteroids Duchenne muscular dystrophy Arginine (NPC226453) NP level
NCT00189007 Antenatal Allopurinol During Fetal Hypoxia fetal hypoxia Mannitol (NPC86412) NP level
NCT02861898 Super-selective Intra-arterial Repeated Infusion of Cetuximab for the Treatment of Newly Diagnosed Glioblastoma brain cancer;glioblastoma multiforme Mannitol (NPC86412) NP level
NCT01843088 Trial of Mannitol Cream for Pain Relief After a Long Run pain Mannitol (NPC86412) NP level
NCT04249336 Clinical Efficacy Of BioMin F, Colgate Sensitive Pro-Relief And Sensodyne Rapid Action Dentifrices In DH allergic disease Arginine (NPC226453) NP level
NCT03088345 Early Use of Vasopressin in Post-Fontan Management congenital heart disease Arginine (NPC226453) NP level
NCT03640949 Vasopressin and Methylprednisolone for In-Hospital Cardiac Arrest sudden cardiac arrest Arginine (NPC226453) NP level
NCT01439555 Endothelial Facilitation in Alzheimer's Disease Alzheimer disease Arginine (NPC226453) NP level
NCT04488874 Sodium Lactate and Brain Relaxation (LSD) intracranial hypertension Mannitol (NPC86412) NP level
NCT00345150 Effects of Inhibition of NO-Synthesis on Renal Hemodynamics and Sodium Excretion in Patients With Essential Hypertension and Healthy Controls hypertension Arginine (NPC226453) NP level
NCT02291458 L-arginine and Brown Adipose Tissue Glucose intolerance Arginine (NPC226453) NP level
NCT05129748 Efficacy of Sodium Thiosulfate and Mannitol in Reducing Ototoxicity in Adult Patients Receiving Cisplatin Chemotherapy hearing loss Mannitol (NPC86412) NP level
NCT00405665 The Short Term Safety and Efficacy of Inhaled L-arginine in Patients With Cystic Fibrosis cystic fibrosis Arginine (NPC226453) NP level
NCT00056433 Evaluation of Hydroxyurea Plus L-arginine or Sildenafil to Treat Sickle Cell Anemia sickle cell anemia Arginine (NPC226453) NP level
NCT01142505 Wheeze and Intermittent Treatment wheezing Mannitol (NPC86412) NP level
NCT00446667 A Pilot Safety Study of Inhaled Dry Powder Mannitol in Acute Exacerbations of COPD chronic obstructive pulmonary disease Mannitol (NPC86412) NP level
NCT04394143 Effect of AD128 to Treat Obstructive Sleep Apnea obstructive sleep apnea Mannitol (NPC86412) NP level
NCT00616304 Safety and Preliminary Efficacy of L-arginine in Severe Falciparum Malaria Plasmodium falciparum malaria Arginine (NPC226453) NP level
NCT01603446 L-arginine Therapy on Endothelium-dependent Vasodilation & Mitochondrial Metabolism in MELAS Syndrome MELAS Arginine (NPC226453) NP level
NCT00446680 Long Term Administration of Inhaled Dry Powder Mannitol In Cystic Fibrosis - A Safety and Efficacy Study cystic fibrosis Mannitol (NPC86412) NP level
NCT00005107 Role of Nitric Oxide in Cirrhosis: Relationship With Systemic Hemodynamics, Renal Function, Vasoactive Systems and Endotoxemia cirrhosis of liver Arginine (NPC226453) NP level
NCT02440061 Ghrelin and Beta Cell Function in Diabetes type 2 diabetes mellitus Arginine (NPC226453) NP level
NCT01718964 Acute Effects of Cortisol on Heroin Craving in Opioid Dependence (Ghost-Basel) opioid dependence Mannitol (NPC86412) NP level
NCT00455130 A Phase 2 Study to Determine the Safety and Efficacy of Inhaled Dry Powder Mannitol in Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT00917826 Study of Arginine Butyrate and Ganciclovir/Valganciclovir in EBV(+) Lymphoid Malignancies lymphoma Arginine (NPC226453) NP level
NCT03636971 Gait Analysis Following Knee Viscosupplementation osteoarthritis Mannitol (NPC86412) NP level
NCT04385264 COVID-19 Mannitol (NPC86412) NP level
NCT03446456 Vasopressin and Pain Perception in the Brain pain Arginine (NPC226453) NP level
NCT01485315 Transfusion-requirements in Septic Shock Trial septic shock Mannitol (NPC86412) NP level
NCT02484170 Mannitol Cream for Post Herpetic Neuralgia postherpetic neuralgia Mannitol (NPC86412) NP level
NCT01606787 Mannitol Use During Partial Nephrectomy Prior to Renal Ischemia and Impact on Renal Function Outcomes kidney cancer Mannitol (NPC86412) NP level
NCT00137124 L-Arginine Metabolism in Essential Hypertension essential hypertension Arginine (NPC226453) NP level
NCT01028339 Mannitol vs HS to Treat ICHT After Severe TBI : Comparison on PtiO2 and Microdialysis Values brain injury Mannitol (NPC86412) NP level
NCT02516085 Improved Muscle Function in Duchenne Muscular Dystrophy Through L-Arginine and Metformin Duchenne muscular dystrophy Arginine (NPC226453) NP level
NCT00792714 Pharmacokinetics of Inhaled Mannitol in Cystic Fibrosis Patients cystic fibrosis Mannitol (NPC86412) NP level
NCT03573999 Effect of Mannitol 20% Versus Hypertonic Saline 7.5% in Brain Metabolism and Oxygenation brain edema Mannitol (NPC86412) NP level
NCT02447874 Arginine Therapy for the Treatment of Pain in Children With Sickle Cell Disease sickle cell anemia Arginine (NPC226453) NP level
NCT00277537 Safety and Efficacy of Bronchitol in Bronchiectasis Bronchiectasis Mannitol (NPC86412) NP level
NCT00303849 Carboplatin, Melphalan, Etoposide Phosphate, Mannitol, and Sodium Thiosulfate in Treating Patients With Previously Treated Brain Tumors anaplastic oligodendroglioma Mannitol (NPC86412) NP level
NCT02570971 Mannitol Versus Supportive Care in Ciguatera Fish Poisoning ciguatera poisoning Mannitol (NPC86412) NP level
NCT02388178 To Determine the Ability of a New Product Formulation to Remineralize an Early Caries Lesion by an In-situ Study dental caries Arginine (NPC226453) NP level
NCT03861416 "Unifuzol®" in Patients With Peripheral Arterial Disease peripheral arterial disease Arginine (NPC226453) NP level
NCT01287585 Ph 3 ADI-PEG 20 Versus Placebo in Subjects With Advanced Hepatocellular Carcinoma Who Have Failed Prior Systemic Therapy hepatocellular carcinoma Arginine (NPC226453) NP level
NCT04631536 Managing Endothelial Dysfunction in COVID-19 : A Randomized Controlled Trial at LAUMC COVID-19 Arginine (NPC226453) NP level
NCT01607879 Use of β-hydroxy-β-methylbutyrate to Counteract Muscle Loss in Men With Prostate Cancer on Androgen Ablation prostate cancer Arginine (NPC226453) NP level
NCT00408577 Prevention of Cardiac and Vascular Events in Patients With NGT/IGT. cardiovascular disease Arginine (NPC226453) NP level
NCT00677339 L-arginine and Vitamin D Adjunctive Therapy in Pulmonary Tuberculosis (TB) pulmonary tuberculosis Arginine (NPC226453) NP level
NCT05470998 L-Arginine in Children Having Sickle Cell Disease With Increased Tricuspid Regurgitant Jet Velocity sickle cell anemia Arginine (NPC226453) NP level
NCT01142219 L-Arginine and Sickle Cell Disease sickle cell anemia Arginine (NPC226453) NP level
NCT01233492 Boron Phenylalanine With or Without Mannitol in Treating Patients With Glioblastoma Multiforme Central Nervous System Neoplasm Mannitol (NPC86412) NP level
NCT02017249 Efficacy Study of Oral Arginine to Improve Immune Function in Glioblastoma Multiforme glioblastoma multiforme Arginine (NPC226453) NP level
NCT00200746 Treatment of Alcohol-Related Hepatitis With Arginine Hepatitis, Alcoholic Arginine (NPC226453) NP level
NCT00134433 Endothelial Modulation for Angiogenic Therapy coronary artery disease Arginine (NPC226453) NP level
NCT00280683 Effects of L-arginine Supplementation in Adults With Moderate to Severe Asthma asthma Arginine (NPC226453) NP level
NCT04217421 Cerebrum and Cardiac Protection With Allopurinol in Neonates With Critical Congenital Heart Disease Requiring Cardiac Surgery With Cardiopulmonary Bypass congenital heart disease Mannitol (NPC86412) NP level
NCT01324115 NG-Nitro-L-Arginine in Treating Patients With Advanced Solid Tumors neoplasm Arginine (NPC226453) NP level
NCT00113854 Mannitol as Adjunct Therapy for Childhood Cerebral Malaria malaria Mannitol (NPC86412) NP level
NCT04534465 Study to Gather Information on the Acceptability of a New Flavor System With Increasing Levels of 2, 4, 6 g or Higher of Mannitol for PEG 3350 in Subjects Having Infrequent Bowel Movements. Constipation Mannitol (NPC86412) NP level
NCT00569088 Study of the Pathogenesis and Molecular Mechanism of "YURE" in Internal Intractable Diseases stroke Mannitol (NPC86412) NP level
NCT00974714 L-arginine Effects on Chronic Hypertension in Pregnancy preeclampsia Arginine (NPC226453) NP level
NCT04535427 Role of L-Arginine Supplementation in the Treatment of Rheumatoid Arthritis rheumatoid arthritis Arginine (NPC226453) NP level
NCT05305508 Assessment of the Efficacy of Calcium Dobesilate vs. Placebo on SARS-CoV-2 Viral Load Amongst Outpatients With COVID-19. COVID-19 Mannitol (NPC86412) NP level
NCT00006136 Phase II Study of Arginine Butyrate With or Without Epoetin Alfa in Patients With Thalassemia Intermedia Beta-thalassemia Arginine (NPC226453) NP level
NCT00730977 A Pilot Study to Investigate Administration of Mannitol Via a Novel Dry Powder Inhaler Device Bronchiectasis Mannitol (NPC86412) NP level
NCT03679780 The Effect of Endothelin and L-Arginine on Racial Differences in Vasoconstriction cardiovascular disease Arginine (NPC226453) NP level
NCT00157521 L-Arginine in Pre-Eclampsia preeclampsia Arginine (NPC226453) NP level
NCT01887197 Repeatability and Response Study of Absorptive Clearance Scans cystic fibrosis Mannitol (NPC86412) NP level
NCT00669331 Inhaled Mannitol as a Mucoactive Therapy for Bronchiectasis Bronchiectasis Mannitol (NPC86412) NP level
NCT05042024 Supplementation With L-ornithine But Not L-arginine Increases Density of CD68+ and CD163+ Macrophages in Periodontitis periodontitis Arginine (NPC226453) NP level
NCT04750902 A Clinical Trial to Assess the Safety and the Anti-caries Efficacy of COL 101 (Arginine) Non-fluoride Dentifrices in Comparison With 0.24% Sodium Fluoride (1100 Ppm F) Dentifrice Control in 10 to 14-year-old Children dental caries Arginine (NPC226453) NP level
NCT00513617 Effectiveness of Arginine as a Treatment for Sickle Cell Anemia sickle cell anemia Arginine (NPC226453) NP level
NCT01263041 Effect of L-arginine and Glutamine on Preterm Sepsis Arginine (NPC226453) NP level
NCT02728687 Topical Menthol +/- Mannitol for Painful Diabetic Peripheral Neuropathy diabetic neuropathy Mannitol (NPC86412) NP level
NCT03749408 Effect of Addition of Mannitol to Bupivacaine on IANB Success and Post-endodontic Pain pulpitis Mannitol (NPC86412) NP level
NCT00344916 Phase 1 Study of L-NMMA in Patients With Liver Cirrhosis cirrhosis of liver Arginine (NPC226453) NP level
NCT00117208 Comparison of Inhaled Mannitol and rhDNase in Children With Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT00810940 Controlled Trial of ABELADRUG200 in Closed, Severe Head Injury injury Mannitol (NPC86412) NP level
NCT00571766 Effects of Oral L-Arginine on Chronic Hypertension in Pregnancy preeclampsia Arginine (NPC226453) NP level
NCT03580122 The Effect of Arginine on Classic Galactosemia classic galactosemia Arginine (NPC226453) NP level
NCT00344734 Effects of Acute L-NMMA Treatment on Renal Hemodynamics and Vasoactive Hormones in Patients With Congestive Heart Failure congestive heart failure Arginine (NPC226453) NP level
NCT04054973 L-arginine Study for Persistent Symptoms of Schizophrenia schizophrenia Arginine (NPC226453) NP level
NCT00345605 Arginine and Buphenyl in Patients With Argininosuccinic Aciduria (ASA), a Urea Cycle Disorder argininosuccinic aciduria Arginine (NPC226453) NP level
NCT00359697 Comparison of Two Different Medications Used to Treat Elevated Intracranial Pressure intracranial hypertension Mannitol (NPC86412) NP level
NCT00251056 Mannitol Dose Response Study in Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT01076491 High Dose Inhaled Mannitol Study Bronchiectasis Mannitol (NPC86412) NP level
NCT04870073 Retrograde Autologous Priming and Mannitol for Reducing Hemodilution in Cardiac Surgery coronary artery disease Mannitol (NPC86412) NP level
NCT01520207 Mannitol - Potential Role in Hemodialysis Initiation for Reduction of Intra-dialytic Hypotension hypotension Mannitol (NPC86412) NP level
NCT00701987 Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma melanoma Betulinic Acid (NPC264317) NP level
NCT01266018 Study of ADI-PEG 20 in Patients With Relapsed Sensitive or Refractory Small Cell Lung Cancer small cell lung carcinoma Arginine (NPC226453) NP level
NCT00346502 Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia) dysplastic nevus Betulinic Acid (NPC264317) NP level
NCT01883531 Crossover Trial Determining the Efficacy of Dry Powder Mannitol to Improve Lung Function in Subjects Aged 6-17 Years cystic fibrosis Mannitol (NPC86412) NP level
NCT00223717 Treatment of Supine Hypertension in Autonomic Failure hypertension Arginine (NPC226453) NP level
NCT02037815 Correlation of Measured and Calculated Serum Osmolality During Hyperosmolar Drugs Infusion in Patients After Craniotomy brain edema Mannitol (NPC86412) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CA12,F3,TDP1,TP53,HSD17B10,PTPN1,CA9
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 AKR1B10,CES1,F2,PTPN1,CA9,PTPRC,CDC25B
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,AKR1B10,CA9,CA12,AKR1B10,CA9,CDC25B
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,AKR1B10,TDP1,TP53,CA9,PTPRC
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA12,AKR1B10,TDP1,CA9,PTPRC,CDC25B
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CA9,CA12,NFKB1,F3,TP53
Sickle-cell disorder
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A51
 NCT02447874,NCT00056433,NCT01142219,NCT00513617,NCT05470998
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 AKR1B10,TDP1,TP53,HSD17B10,CA9
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 AKR1B10,CA9,PTPRC,CA9,F2
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 AKR1B10,HSD17B10,NFKB1,PTPRC,CA9
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NFKB1,PTPN1,F2
 NCT02440061
Bronchiectasis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA24
 NCT00730977,NCT01076491,NCT00277537,NCT00669331
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA12,AKR1B10,F2,CA9
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,AKR1B10,CA9,F2
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA12,AKR1B10,PTPRC,CA9
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA12,F2,PTPRC,CDC25B
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 PTPRC,NFKB1,TP53
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2
 NCT00408577,NCT03679780
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 PTPN1,CA9,CA12
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 CA9,PTPRC
 NCT00917826
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 NCT01796678,NCT01843088,NCT03446456
Malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F40-1F45
 NCT00113854,NCT00616304,NCT00147368
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04385264,NCT05305508,NCT04631536
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 NCT00157521,NCT00571766,NCT00974714
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 F3,TP53,CA9
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 PTPN1,AKR1B10,CDC25B
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 F2,CA9,CDC25B
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,AKR1B10,CA9
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 AKR1B10,CA9,F2
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NFKB1
 AKR1B10
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 NFKB1
 NCT04535427
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 CES1,TP53
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 NFKB1,F2
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2,F3
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 F2
 NCT00569088
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53,PTPRC
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 PTPRC,TP53
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 F3,TP53
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2
 NCT00280683
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 TP53
 NCT02861898
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT00134433,NCT04870073
Structural developmental anomaly of heart or great vessels, unspecified
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA8Z
 NCT04217421,NCT03088345
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 NCT00005107,NCT00344916
Duchenne muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.1
 NCT02516085,NCT01388764
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT02017249,NCT02861898
Cerebral oedema
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D60.1
 NCT03573999,NCT02037815
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 NCT00345150,NCT00223717
Other specified increased intracranial pressure
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D60.Y
 NCT04488874,NCT00359697
Dental caries
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA08.0
 NCT02388178,NCT04750902
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA12,AKR1B10
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2,CDC25B
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 CA9,F2
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 F3,F2
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12,CA9
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA12,CA9
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 NCT00405665,NCT00446680,NCT02134353,NCT00630812,NCT00117208,NCT00792714,NCT00455130,NCT01883531,NCT01887197,NCT00251056
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 TP53
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 NFKB1
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 TP53
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 CDC25B
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 PTPN1
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 F2
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 NFKB1
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 PTPRC
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 CDC25B
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 CA9
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 NFKB1
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12
Ophthalmic devices/implants/grafts injury
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PK97
 PTPN1
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 PTPN1
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 TP53
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 PTPRC
Acute respiratory distress syndrome
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB00
 F3
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NFKB1
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 TP53
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 PTPN1
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 PTPN1
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 TP53
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 PTPRC
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 CES1
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 NFKB1
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 TP53
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 TP53
Peroxisomal disease
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C57
 CES1
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1
Synthesis disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52-5C59
 CES1
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 F2
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 TP53
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Oligodendroglioma, anaplastic
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH8844
 NCT00303849
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 NCT00701987
Exposure to or harmful effects of undetermined intent of other or unspecified substances chiefly nonmedicinal as to source
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PH56
 NCT02570971
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 NCT00047983
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 NCT01607879
Hypotension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA20-BA21
 NCT01520207
Periodontal disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA0C
 NCT05042024
Galactose-1-phosphate uridyltransferase deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C51.40
 NCT03580122
Dysplastic naevus
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH9035
 NCT00346502
Chronic arterial occlusive disease, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 NCT03861416
Constipation
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05.0
 NCT04534465
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 NCT01263041
Cardiac arrest
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MC82
 NCT03640949
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 NCT00137124
Wheezing
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD11.C
 NCT01142505
Chronic myeloid leukaemia, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4XG8
 NCT03747679
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 NCT04249336
Melasma
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60.1
 NCT01603446
Postherpetic polyneuropathy
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E91.5
 NCT02484170
Argininosuccinic aciduria
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50.A0
 NCT00345605
Septic shock
Disease Category: X.Extension Codes
Disease ICD-11 Code: XS26
 NCT01485315
Tuberculosis of the respiratory system
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B10
 NCT00677339
Hepatocellular carcinoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4W48
 NCT01287585
Hearing disorder
Disease Category: 10.Diseases of the ear or mastoid process
Disease ICD-11 Code: AB50-AB57
 NCT05129748
Pulpitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA09.0
 NCT03749408
Intracranial injury, unspecified
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NA07.Z
 NCT01028339
Alcoholic hepatitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB94.1
 NCT00200746
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 NCT00446667
Diabetic polyneuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C03.0
 NCT02728687
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT01324115
Congestive heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10
 NCT00344734
Central nervous system disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A04-8D87
 NCT01233492
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 NCT04054973
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 NCT03636971
Other specified disorders of carbohydrate absorption or transport
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C61.Y
 NCT02291458
Maternal care for signs of fetal hypoxia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA86.2
 NCT00189007
Obstructive sleep apnoea
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A41
 NCT04394143
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 NCT01439555
Beta thalassaemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A50.2
 NCT00006136
Small cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.1
 NCT01266018
Opioid use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C43
 NCT01718964
Unspecific body region injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56
 NCT00810940
Malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 NCT01606787
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 NFKB1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 PTPRC
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 CDC25B
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CA9
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CA9
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 F3
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 F3
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group