CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Trichilia Catigua

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAACGACCCGCGAACTTGTGATTATCTCGAGGGGGGACGGCGTGGGGAGCTCTGCTGCCCTCGTTGGCCCCCTCCTGCTGTGGGGGGTGAGGGGGATCTCTCGCTCGCTCCTCGCAGCAGAACAACAAACCCCCGGCGCGAGCTGCGCCAAGGAAAATTTAACGAGAGCGAGCGCTCCCGCCGCCCCGGACACGGATCGACGTGCGGGATGCGTCTCATTCTTTCAATGAAAATCAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATTGTTGCCCCCCCAACCCCTCTTGGGGAATAGCTGGTCGGGCGAAAACTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCCAAATCTGAGTCTTTCGGCGACCGTGCCGCGACGATCGGTGGTGTAACATGCCTCTCGAGCTCCTGTCGCGCGCTCGCGTTTCCGTGCCATTGGCTCGCGAACCCTTGTCAGCGCCTTCTCTTCGAGACGGTGCTCGCT

Click for details-----ITS1

Click for details-----ITS2

ATTGTTGCCCCCCCAACCCCTCTTGGGGAATAGCTGGTCGGGCGAAAACTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCCAAATCTGAGTCTTTCGGCGACCGTGCCGCGACGATCGGTGGTGTAACATGCCTCTCGAGCTCCTGTCGCGCGCTCGCGTTTCCGTGCCATTGGCTCGCGAACCCTTGTCAGCGCCTTCTCTTCGAGACGGTGCTCGCT

Taxonomic Information

Plant ID: NPO27850
Plant Latin Name: Trichilia Catigua
Taxonomy Genus: Trichilia
Taxonomy Family: Meliaceae

Plant External Links:

NCBI TaxonomyDB: 1640457
Plant-of-the-World-Online: 579374-1

Used in Medicines

Country/Region:

Brazil; Paraguay; Argentina; Bolivia

Traditional Medicine System:

Geographical Distribution

Brazil; Paraguay; Argentina; Bolivia

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

80 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97556

Ingredient ID: NPC97291

Ingredient ID: NPC95906

Ingredient ID: NPC94314

Ingredient ID: NPC87582

Ingredient ID: NPC85925

Ingredient ID: NPC82800

Ingredient ID: NPC70147

Ingredient ID: NPC6984

Ingredient ID: NPC69432

Ingredient ID: NPC65453

Ingredient ID: NPC62559

Ingredient ID: NPC60291

Ingredient ID: NPC44957

Ingredient ID: NPC44905

Ingredient ID: NPC42605

Ingredient ID: NPC41315

Ingredient ID: NPC37832

Ingredient ID: NPC36362

Ingredient ID: NPC32163

Ingredient ID: NPC305900

Ingredient ID: NPC304032

Ingredient ID: NPC299536

Ingredient ID: NPC296496

Ingredient ID: NPC296073

Ingredient ID: NPC294419

Ingredient ID: NPC29341

Ingredient ID: NPC293160

Ingredient ID: NPC292489

Ingredient ID: NPC2918

Ingredient ID: NPC290015

Ingredient ID: NPC288580

Ingredient ID: NPC268826

Ingredient ID: NPC265844

Ingredient ID: NPC254633

Ingredient ID: NPC243670

Ingredient ID: NPC237685

Ingredient ID: NPC236824

Ingredient ID: NPC236709

Ingredient ID: NPC228395

Ingredient ID: NPC226284

Ingredient ID: NPC222847

Ingredient ID: NPC215206

Ingredient ID: NPC214610

Ingredient ID: NPC211965

Ingredient ID: NPC201551

Ingredient ID: NPC199478

Ingredient ID: NPC196069

Ingredient ID: NPC192657

Ingredient ID: NPC191472

Ingredient ID: NPC190364

Ingredient ID: NPC189126

Ingredient ID: NPC17778

Ingredient ID: NPC175216

Ingredient ID: NPC17454

Ingredient ID: NPC169718

Ingredient ID: NPC168957

Ingredient ID: NPC168206

Ingredient ID: NPC161617

Ingredient ID: NPC160573

Ingredient ID: NPC157912

Ingredient ID: NPC155754

Ingredient ID: NPC154288

Ingredient ID: NPC150919

Ingredient ID: NPC133926

Ingredient ID: NPC127153

Ingredient ID: NPC125589

Ingredient ID: NPC124747

Ingredient ID: NPC123587

Ingredient ID: NPC121745

Ingredient ID: NPC121319

Ingredient ID: NPC121205

Ingredient ID: NPC118478

Ingredient ID: NPC114942

Ingredient ID: NPC113864

Ingredient ID: NPC113773

Ingredient ID: NPC110899

Ingredient ID: NPC107066

Ingredient ID: NPC101508

Ingredient ID: NPC100634

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	27

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03418610	Azelaic Acid Foam 15% in the Treatment of Papulopustular Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT03689010	To Evaluate the Therapeutic Equivalence and Safety in Treatment of Moderate Facial Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT00992667	Inhaled Apocynin Decreases Reactive Oxygen Species Concentrations in Exhaled Breath Condensate in Mild Asthmatics	asthma	Apocynin (NPC32163)	NP level
NCT01555463	Safety and Efficacy of Azelaic Acid Foam, 15 % in Papulopustular Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT00855595	Efficacy of Topical Azelaic Acid 15% Gel Plus Anti-inflammatory Dose Doxycycline or Metronidazole Gel 1% Plus Anti-inflammatory Dose Doxycycline in Moderate Papulopustular Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT00408330	A Study of Azelaic Acid (AzA) 15% Gel in the Treatment of Seborrheic Dermatitis of the Face	seborrheic dermatitis	Azelaic Acid (NPC214610)	NP level
NCT03680638	The Effect of Antioxidants on Skin Blood Flow During Local Heating	cardiovascular disease	Apocynin (NPC32163)	NP level
NCT02120924	A Study to Evaluate the Safety and Clinical Study of Azelaic Acid Gel 15% in Patients With Moderate Facial Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT04649203	Cytoflavin in the Treatment of Patients With Diabetic Polyneuropathy	diabetic neuropathy	Succinic Acid (NPC236709)	NP level
NCT01402297	Hydrogen Peroxide and Nitrite Reduction in Exhaled Breath Condensate of COPD Patients	chronic obstructive pulmonary disease	Apocynin (NPC32163)	NP level
NCT00617903	Exploration of Safety and Efficacy of AzA 15% Foam Twice a Day in Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT02147691	Finacea 15% and Brimonidine 0.33% Gel in the Treatment of Rosacea - A Pilot Study	rosacea	Azelaic Acid (NPC214610)	NP level
NCT01387048	Study for Long-term Treatment of Acne Vulgaris With Skinoren Versus Differin	acne	Azelaic Acid (NPC214610)	NP level
NCT01493687	Phase 3 Papulopustular Rosacea Study	rosacea	Azelaic Acid (NPC214610)	NP level
NCT03094403	To Evaluate the Therapeutic Equivalence and Safety of Azelaic Acid 15% Topical Gel	rosacea	Azelaic Acid (NPC214610)	NP level
NCT01494467	Phase 3 Papulopustular Rosacea Study	rosacea	Azelaic Acid (NPC214610)	NP level
NCT00403949	A Study of Azelaic Acid (AzA) 15% in Topical Treatment of Mild to Moderate Perioral Dermatitis	Dermatitis, Perioral	Azelaic Acid (NPC214610)	NP level
NCT01257919	Safety and Pharmacokinetics of Azelaic Acid Foam, 15% in Papulopustular Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT02058628	Comparison of the Efficacy and Safety of Clindamycin + Benzoyl Peroxide Formulation With Azelaic Acid Formulation in the Treatment of Acne Vulgaris	acne	Azelaic Acid (NPC214610)	NP level
NCT00031096	Comparison of Efficacy and Safety of Azelaic Acid 15% Gel With Its Vehicle in Subjects With Mild to Moderate Acne	acne	Azelaic Acid (NPC214610)	NP level
NCT03287791	A Study to Evaluate Safety and Equivalence of Generic Azelaic Acid Foam and Finacea® Foam in Participants With Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT01025635	Safety and Efficacy of Azelaic Acid Foam, 15% in Papulopustular Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT05014906	Efficacy of Oral Minocycline (Solodyn) and Oral Minocycline (Solodyn) Plus Azelaic Acid (Finacea) for Acne Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level
NCT03680573	The Effect of Antioxidants on Skin Blood Flow-BH4	cardiovascular disease	Apocynin (NPC32163)	NP level
NCT00417937	A Multicenter Trial of a Topical Medication for Papulopustular Rosacea Applied Twice Daily Versus Once Daily	rosacea	Azelaic Acid (NPC214610)	NP level
NCT02800148	Bioequivalence Study of Two Treatments in the Treatment of Inflammatory Lesions of Rosacea on the Face	rosacea	Azelaic Acid (NPC214610)	NP level
NCT03035955	Azelaic Acid on Demodex Counts in Rosacea	rosacea	Azelaic Acid (NPC214610)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	NCT01387048,NCT02058628,NCT00031096
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	NCT03680638,NCT03680573
Rosacea Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED90	NCT01493687,NCT01025635,NCT00855595,NCT03035955,NCT03689010,NCT00617903,NCT01494467,NCT01257919,NCT03094403,NCT00417937,NCT02800148,NCT05014906,NCT03418610,NCT03287791,NCT01555463,NCT02147691,NCT02120924
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	NFKB1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Periorificial dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED90.1	NCT00403949
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NCT00992667
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	NCT00408330
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT04649203
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT01402297
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	LMNA
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	NFKB1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Trichilia Catigua

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

80 All known Ingredients in Total

14 Ingredients with Acceptable Bioavailablity

14 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acne vulgaris

Cardiovascular disease

Rosacea

Rheumatoid arthritis

Atopic eczema

Fungal infection

Irritable bowel syndrome

Acute myeloid leukaemia

Solid tumour/cancer

Psoriasis

Choreiform disorder

Skin and skin-structure infection

Acute/subacute hepatic failure

Lupus erythematosus

Multiple sclerosis

Diabetes mellitus, type unspecified

Indeterminate colitis

Type 2 diabetes mellitus

Muscular dystrophy

Periorificial dermatitis

Asthma

Seborrhoeic dermatitis

Diabetic polyneuropathy

Chronic obstructive pulmonary disease

Malignant neoplasms of biliary tract, distal bile duct

Diffuse large B-cell lymphomas

West Nile virus infection

Adenocarcinoma of pancreas

Mesothelioma of pleura

Superficial ovarian endometriosis

Chikungunya virus disease

Malignant neoplasms of thymus

Glioblastoma of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities