CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Uncaria Tomentosa

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTGAACAATCGGGCGTCGGGCGGTAAGGGAGACTAAGCCCTCCATTCCCACCCGGCGCTCCCCGCGCGCTTGTCGCGCGGAAAACGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGACAGCCGGGCCCTCGATGCCCCGTACGCGGTGTGCTCGGGGTGCTGTGGCGCCTGTCGTAATCCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCTAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCGCCCCCACCTATCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTTTGGCGCGGCCGGCCTAAACGAGAGTCCTCGGCGAGGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGATTTTTGTCGTGCCGGTTCCCGTCGTCGTCTTCGGCTCCATGGATGACCCTAGTGCGCGATCTGTTGCAGTCGCGC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCGCCCCCACCTATCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTTTGGCGCGGCCGGCCTAAACGAGAGTCCTCGGCGAGGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGATTTTTGTCGTGCCGGTTCCCGTCGTCGTCTTCGGCTCCATGGATGACCCTAGTGCGCGATCTGTTTGCAGTCGCGCCCCGA

Taxonomic Information

Plant ID: NPO26547
Plant Latin Name: Uncaria Tomentosa
Taxonomy Genus: Uncaria
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 128375
Plant-of-the-World-Online: 768322-1

Used in Medicines

Country/Region:

Brazil; China; Bolivia; Venezuela; Ecuador

Traditional Medicine System:

TCM

Geographical Distribution

Brazil; Belize; Honduras; Peru; Suriname; Venezuela; Costa Rica; Trinidad and Tobago; Guatemala; China; Colombia; Guyana; French Guiana; Bolivia; Nicaragua; Ecuador

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

47 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97380

Ingredient ID: NPC79420

Ingredient ID: NPC7543

Ingredient ID: NPC71424

Ingredient ID: NPC56726

Ingredient ID: NPC47920

Ingredient ID: NPC475826

Ingredient ID: NPC473698

Ingredient ID: NPC473481

Ingredient ID: NPC3166

Ingredient ID: NPC307292

Ingredient ID: NPC305238

Ingredient ID: NPC304741

Ingredient ID: NPC30397

Ingredient ID: NPC29883

Ingredient ID: NPC297208

Ingredient ID: NPC293255

Ingredient ID: NPC276993

Ingredient ID: NPC274507

Ingredient ID: NPC264711

Ingredient ID: NPC259896

Ingredient ID: NPC258885

Ingredient ID: NPC251921

Ingredient ID: NPC244572

Ingredient ID: NPC243227

Ingredient ID: NPC235841

Ingredient ID: NPC228346

Ingredient ID: NPC221342

Ingredient ID: NPC219876

Ingredient ID: NPC211798

Ingredient ID: NPC210415

Ingredient ID: NPC207983

Ingredient ID: NPC206728

Ingredient ID: NPC187933

Ingredient ID: NPC177927

Ingredient ID: NPC168871

Ingredient ID: NPC166456

Ingredient ID: NPC159563

Ingredient ID: NPC158733

Ingredient ID: NPC145388

Ingredient ID: NPC143693

Ingredient ID: NPC126029

Ingredient ID: NPC124296

Ingredient ID: NPC118519

Ingredient ID: NPC112361

Ingredient ID: NPC111602

Ingredient ID: NPC108748

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	ALPL	Alkaline phosphatase, tissue-nonspecific isozyme	P05186	CHEMBL5979
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3
Plant level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01856868	Use of (-)-Epicatechin in the Treatment of Becker Muscular Dystrophy (Pilot Study)	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT03236662	(-)- Epicatechin Becker Muscular Dystrophy	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT01880866	(-)-Epicatechin and Pulmonary Arterial Hypertension	pulmonary arterial hypertension	(-)-Epicatechin (NPC126029)	NP level
NCT02045719	Phase II Clinical Trial of Uncaria Tomentosa (Cat´s Claw) in Patients With Advanced Solid Tumors	Solid Tumors	Uncaria Tomentosa	Plant level As single plant

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DRD1,NFKB1,HSD17B10
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	NFKB1 NCT02045719
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD1 NCT01880866
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA,DRD1
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT01856868,NCT03236662
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HSD17B10,ALPL
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DRD1,SNCA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DRD1,SNCA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DRD1,SNCA
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	DRD1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD1
Genetic prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E02	ALPL
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	ALPL
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Parasitic infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D0Y-1G2Z	ALPL
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	ALPL
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALPL
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	SNCA
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	ALPL
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	ALPL
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	ALPL
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	HSD17B10
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	SNCA
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	ALPL
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	ALPL
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SNCA

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Uncaria Tomentosa

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

47 All known Ingredients in Total

18 Ingredients with Acceptable Bioavailablity

26 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of thymus

Solid tumour/cancer

Pulmonary hypertension

Parkinsonism

Becker muscular dystrophy

Carcinosarcoma of uterus

Adenocarcinoma of pancreas

Mesothelioma of pleura

Germ cell tumour of testis

Skin and skin-structure infection

Acute/subacute hepatic failure

Rheumatoid arthritis

Type 2 diabetes mellitus

Dementia

Schizophrenia

Genetic prion disease

Indeterminate colitis

Multiple sclerosis

Colon cancer

Choreiform disorder

Psoriasis

Abortion

Irritable bowel syndrome

Tic disorder

Fungal infection

Diabetes mellitus, type unspecified

Psychotic disorder

Autonomic nervous system disorder

Parasitic infection

Lupus erythematosus

Alzheimer disease

Acute myeloid leukaemia

Atopic eczema

Muscular dystrophy

Cocaine use disorder

Allergic/hypersensitivity disorder

Crohn disease

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Inflammatory bowel diseases, unspecified

Osteoarthritis, unspecified

Leishmaniasis

Adenocarcinoma of stomach

Diffuse large B-cell lymphomas

West Nile virus infection

Superficial ovarian endometriosis

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities