CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Fritillaria Stenanthera

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAGAACCGATTGAAAGACCGCGAACCTGTAAATGGATGATACCGTGTGGGGCGGACATTTACTTTGCCCGCCCTGTTCGGGACCTCGCCTCGTGTTTGGGATTGCCTCCGGGCACTCGAGACATGATTTGCGGGGGACGGACGAAACCCCGGCGCGGCCTGCGCCAAGGAACATATGACAGGACGGATGCACGTCAACGCCTTAGTGGCGGGGCGACGTCCGCTCTCTATCCATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTCGGTTGAGGGCACGCCTGCCTGGGCGTCACGCCTTGTTTCGCTCTGTTCCCATTGCCCCTTGGGGGGTTGTAACCGATGCCGAAAATGGCCCTCCGTGCCTTGTGTTCGGCGGGCTTAAGTGCGGGCTGTCGGTGTCGGGATGGGCACGAACAGTGGTGGACGGAGCACCAGTAGGATGTTGTGGCCCCCCGTTGCCTTAAGGGGGTCAAGAAACCCGAATTAGGCGAGCCGCCCTCCTTTAAGAGGAGGGCTTTCCCTCTCCCAAT

Click for details-----ITS1

Click for details-----ITS2

CTTGTTTCGCTCTGTTCCCATTGCCCCTTGGGGGGTTGTAACCGATGCCGAAAATGGCCCTCCGTGCCTTGTGTTCGGCGGGCTTAAGTGCGGGCTGTCGGTGTCGGGATGGGCACGAACAGTGGTGGACGGAGCACCAGTAGGATGTTGTGGCCCCCCGTTGCCTTAAGGGGGTCAAGAAACCCGAATTAGGCGAGCCGCCCTCCTTTAAGAGGAGGGCTTTCCCTCTCCCAAT

Taxonomic Information

Plant ID: NPO26187
Plant Latin Name: Fritillaria Stenanthera
Taxonomy Genus: Fritillaria
Taxonomy Family: Liliaceae

Plant External Links:

NCBI TaxonomyDB: 83801
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

15 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC85276

Ingredient ID: NPC60278

Ingredient ID: NPC46801

Ingredient ID: NPC46159

Ingredient ID: NPC38065

Ingredient ID: NPC302248

Ingredient ID: NPC294185

Ingredient ID: NPC271803

Ingredient ID: NPC254702

Ingredient ID: NPC243635

Ingredient ID: NPC239572

Ingredient ID: NPC197313

Ingredient ID: NPC194653

Ingredient ID: NPC151004

Ingredient ID: NPC139134

Ingredient ID: NPC125732

Ingredient ID: NPC118009

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Small molecule receptor (family A GPCR)	TAAR1	Trace amine-associated receptor 1	Q96RJ0	CHEMBL5857
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	9

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04514510	Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT04733651	Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT00748059	The Pathophysiology of Orthostatic Hypotension	orthostatic hypotension;orthostatic intolerance	Tyramine (NPC125732)	NP level
NCT00203125	A Study to Evaluate the Effects of Tyramine in Patients Who Completed the PRESTO Study.	Parkinson disease	Tyramine (NPC125732)	NP level
NCT02446795	Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial	renal cell carcinoma	Isoquercetin (NPC179950)	NP level
NCT04536090	Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02552888	Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial	chronic kidney disease	Isoquercetin (NPC179950)	NP level
NCT04474626	Isoquercetin in Sickle Cell Anemia	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT04622865	Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA4,CA2,KDM1A,CA12
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA4,CA12,CA2
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2,CA12,CA4
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA2,CA12,CA4
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04733651,NCT04622865,NCT04536090
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA7,CA2,KDM1A
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	KDM1A,CA12,LMNA
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	LMNA,CA7,CA2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,LMNA,CA7
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA4,CA12
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,CA4,CA2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,LMNA,CA2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CA4,CA7
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	TAAR1 NCT00203125
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA4,CA2
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT04474626,NCT04514510
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA4,CA2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,CA4
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,CA4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA7
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,CA7
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CA7
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CA2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,CA4
Narcolepsy Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A20	TAAR1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KDM1A
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	KDM1A
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Focal/segmental autonomic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D8A	TAAR1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	TAAR1
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	TAAR1
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	TAAR1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDM1A
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDM1A
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Ewing sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B52	KDM1A
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	KDM1A
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	KDM1A
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	NCT02446795
NA Disease Category: NA Disease ICD-11 Code: NA	NCT00748059
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	NCT02552888
Orthostatic hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA21	NCT00748059
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA4
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Fritillaria Stenanthera

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

17 All known Ingredients in Total

15 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Solid tumour/cancer

Breast cancer

Seborrhoeic dermatitis

Bacterial infection

COVID-19

Carcinosarcoma of uterus

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Parkinsonism

Glaucoma

Sickle-cell disorder

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thyroid gland, unspecified

Adenocarcinoma of bronchus or lung

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

Narcolepsy

Myeloproliferative neoplasm

Mature T-cell lymphoma

Insomnia

Focal/segmental autonomic disorder

Rheumatoid arthritis

Asthma

Schizophrenia

Essential hypertension

Heart failure

Depression

Attention deficit hyperactivity disorder

Lung cancer

Myelodysplastic syndrome

Duodenal ulcer

Low bone mass disorder

Ewing sarcoma

Acute myeloid leukaemia

Malignant haematopoietic neoplasm

Renal cell carcinoma

NA

Chronic kidney disease

Orthostatic hypotension

Osteoarthritis, unspecified

Atrial fibrillation

Keratoconus

Pre-eclampsia

Tetralogy of Fallot

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Invasive carcinoma of breast

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities