CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Hedychium Coronarium

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CGGGTACGCTTACGTAGGTGACCTGCGGAGGATCATTGTTGAGAGAGCACAAGACGATGGATGGTTGTGAATGTGTGAACGCGCCCCTTTCCTCGCCCCGCCCATGTCGGCGGGCGATTGACCGTAGCCGGGTGCGATCGGCACCAAGGAACAATGAACTCGGAAGCAGAGGGCCCCTCGACGTGCGCGGGGGGAGCCCAATGCGTCGGAGACTCCTCGAAATCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCATCGTCGCTTTCGCTCCACGCATTGTTGGCGGCGAGCGGAAATTGGCCCCGTGTGTCCTCGGGCACAGTCGGTCGAAGAGTGGGTAGTCGGCAGTCGTCGGGCACGATGGGTGTTGGTCGCCGCGAGCGGGAACAGAACGTCGTCCCCGTCGTCTCGGGATGAGTCCTCAAGAGACCCTGTGCGAATGCGGCGTCGGCCGAAAGTGCCGCGCCCATCAAA

Click for details-----ITS1

Click for details-----ITS2

CATCGTCGCTTTCGCTCCACGCATTGTTGGCGGCGAGCGGAAATTGGCCCCGTGTGTCCTCGGGCACAGTCGGTCGAAGAGTGGGTAGTCGGCAGTCGTCGGGCACGATGGGTGTTGGTCGCCGCGAGCGGGAACAGAACGTCGTCCCCGTCGTCTCGGGATGAGTCCTCAAGAGACCCTGTGCGAATGCGGCGTCGGCTGCTTATCATTTAGAGGAAGGAGCATATCAATAAGCGGAGGTCTTAAAGGGGG

Taxonomic Information

Plant ID: NPO25518
Plant Latin Name: Hedychium Coronarium
Taxonomy Genus: Hedychium
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: 71610
Plant-of-the-World-Online: 796836-1

Used in Medicines

Country/Region:

Brazil; China; Indonesia; India

Traditional Medicine System:

TCM; Siddha

Medicinal Functions:

Antirheumatic; Aromatic; Carminative; Febrifuge; Stomachic; Tonic

Geographical Distribution

Brazil; Madagascar; Bangladesh; Nepal; Costa Rica; Suriname; Argentina; Bolivia; Venezuela; Ecuador; Australia; Cuba; Papua New Guinea; United States; Trinidad and Tobago; China; Thailand; Haiti; Belize; Philippines; Indonesia; New Caledonia; Mauritius; Sri Lanka; Vietnam; French Guiana; Guyana; Dominican Republic; Jamaica; Honduras; Myanmar; Mexico; South Africa; India; Colombia; Paraguay; Taiwan; Fiji

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

92 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

79 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99321

Ingredient ID: NPC97821

Ingredient ID: NPC96927

Ingredient ID: NPC87466

Ingredient ID: NPC83546

Ingredient ID: NPC79027

Ingredient ID: NPC75485

Ingredient ID: NPC73080

Ingredient ID: NPC52214

Ingredient ID: NPC51758

Ingredient ID: NPC50488

Ingredient ID: NPC48919

Ingredient ID: NPC47294

Ingredient ID: NPC469939

Ingredient ID: NPC469

Ingredient ID: NPC4509

Ingredient ID: NPC45083

Ingredient ID: NPC42564

Ingredient ID: NPC40175

Ingredient ID: NPC39793

Ingredient ID: NPC36002

Ingredient ID: NPC35655

Ingredient ID: NPC329692

Ingredient ID: NPC327886

Ingredient ID: NPC322465

Ingredient ID: NPC318792

Ingredient ID: NPC31409

Ingredient ID: NPC304429

Ingredient ID: NPC300098

Ingredient ID: NPC298410

Ingredient ID: NPC295038

Ingredient ID: NPC293427

Ingredient ID: NPC292952

Ingredient ID: NPC287331

Ingredient ID: NPC286937

Ingredient ID: NPC285802

Ingredient ID: NPC285514

Ingredient ID: NPC282894

Ingredient ID: NPC277907

Ingredient ID: NPC277525

Ingredient ID: NPC276466

Ingredient ID: NPC273965

Ingredient ID: NPC273069

Ingredient ID: NPC272471

Ingredient ID: NPC262094

Ingredient ID: NPC256040

Ingredient ID: NPC251528

Ingredient ID: NPC250667

Ingredient ID: NPC249122

Ingredient ID: NPC247945

Ingredient ID: NPC246392

Ingredient ID: NPC246224

Ingredient ID: NPC244942

Ingredient ID: NPC243728

Ingredient ID: NPC239441

Ingredient ID: NPC230301

Ingredient ID: NPC224224

Ingredient ID: NPC217727

Ingredient ID: NPC217394

Ingredient ID: NPC209451

Ingredient ID: NPC208094

Ingredient ID: NPC206276

Ingredient ID: NPC202474

Ingredient ID: NPC201767

Ingredient ID: NPC199703

Ingredient ID: NPC193142

Ingredient ID: NPC190358

Ingredient ID: NPC1898

Ingredient ID: NPC189434

Ingredient ID: NPC185556

Ingredient ID: NPC178464

Ingredient ID: NPC174362

Ingredient ID: NPC172193

Ingredient ID: NPC170084

Ingredient ID: NPC169275

Ingredient ID: NPC168990

Ingredient ID: NPC168248

Ingredient ID: NPC15702

Ingredient ID: NPC152506

Ingredient ID: NPC149496

Ingredient ID: NPC139954

Ingredient ID: NPC138433

Ingredient ID: NPC130836

Ingredient ID: NPC123235

Ingredient ID: NPC118423

Ingredient ID: NPC113733

Ingredient ID: NPC108758

Ingredient ID: NPC108292

Ingredient ID: NPC107712

Ingredient ID: NPC106508

Ingredient ID: NPC106021

Ingredient ID: NPC102336

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Protein Kinase	MAPK1	MAP kinase ERK2	P28482	CHEMBL4040

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01119534	Comparative Efficacy of the Suppository Versus Guaiacol Suppository Versus Guaifenesin Syrup in Pediatric Patients With Cough Due the Infectious Origin	Cough	Eucalyptol (NPC287331)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2,MAPK1
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	MAPK1
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MAPK1
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MAPK1
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MAPK1
Cough Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD12	NCT01119534
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Hedychium Coronarium

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

92 All known Ingredients in Total

79 Ingredients with Acceptable Bioavailablity

32 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Germ cell tumour of testis

Angina pectoris

Solid tumour/cancer

Coronary thrombosis

Myocardial infarction

Arteries/arterioles disorder

Ischaemic/haemorrhagic stroke

Bleeding disorder

Multiple sclerosis

Type 2 diabetes mellitus

Cerebral ischaemic stroke

Nutritional deficiency

Melanoma

Coagulation defect

Thrombosis

Thrombocytopenia

Asthma

Cardiovascular disease

Pancreatic cancer

Cough

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities