CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Adesmia Boronioides

Example Image

PLANiTS DNA barcode

ATCGTATCCCCAACACCCATTGCCCTCGGGCATTGGGAAGGGGCAAATGCTGGCCTCCCGTGTGCCTTGCCTTGCGGTTGGCTGAAAATCGGGTTCGTGGTGGAGAGCAGCGCCGCGGTACATGGTGGTTGAGCACAATCTCGAGACCAGTCGCGTGTGCCCCTCTGCCGTTTACGGACCCTATGACCCTTGAGTGTGCCTTTGGACGCTCGTGATGCGACCTCAGGTCAGGCGG

Taxonomic Information

Plant ID: NPO23997
Plant Latin Name: Adesmia Boronioides
Taxonomy Genus: Adesmia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 114978
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Argentina; Chile

Traditional Medicine System:

Geographical Distribution

Argentina; Chile

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC35150

Ingredient ID: NPC29883

Ingredient ID: NPC295344

Ingredient ID: NPC270682

Ingredient ID: NPC230301

Ingredient ID: NPC213840

Ingredient ID: NPC209988

Ingredient ID: NPC209676

Ingredient ID: NPC195167

Ingredient ID: NPC18603

Ingredient ID: NPC154275

Ingredient ID: NPC130683

Ingredient ID: NPC111888

Ingredient ID: NPC106328

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	18

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01201954	Pain Relief of Newborn Preterm Infants During Endotracheal Suctioning	pain	Sucrose (NPC130683)	NP level
NCT04855266	Iron Sucrose in Patients With Iron Deficiency and POTS	orthostatic hypotension	Sucrose (NPC130683)	NP level
NCT02174705	Rotavirus vs. Sucrose for Vaccine Injection Pain	pain	Sucrose (NPC130683)	NP level
NCT00787059	AC6 Gene Transfer for CHF	congestive heart failure	Sucrose (NPC130683)	NP level
NCT02086864	A Placebo Controlled Study of Homeopathic Treatment of Children and Youth With ADHD	attention deficit hyperactivity disorder	Sucrose (NPC130683)	NP level
NCT00949104	Role of Oral Sucrose in Reducing the Pain to Orogastric Tube Insertion in Preterm Neonates	pain	Sucrose (NPC130683)	NP level
NCT01190995	Role of Repeated Painful Procedures in Preterm Neonates on Short Term Neurobehavioural Outcome	pain	Sucrose (NPC130683)	NP level
NCT00482560	Analgesic Effect of Breast Feeding vs Sucrose in Neonatal Screening	pain	Sucrose (NPC130683)	NP level
NCT01503060	Effectiveness of Parent-Led Interventions in Reducing Infant Hypersensitivity to Pain	pain	Sucrose (NPC130683)	NP level
NCT03718507	Study on the Effects of Different Premedication for LISA on Stress and Cerebral Tissue Oxygenation in Preterm Infants	acute respiratory distress syndrome	Sucrose (NPC130683)	NP level
NCT01238471	Oral Propranolol Versus Placebo for Early Stages of Retinopathy of Prematurity: A Randomized and Prospective Study	retinopathy of prematurity	Sucrose (NPC130683)	NP level
NCT01561547	Trial of Repeated Analgesia With Kangaroo Care	pain	Sucrose (NPC130683)	NP level
NCT02990364	Combination Analgesia for Neonatal Circumcision	pain	Sucrose (NPC130683)	NP level
NCT03272594	The Influence of Breastfeeding on Cortical Activity During Procedures	pain	Sucrose (NPC130683)	NP level
NCT00519207	Evaluation of Topical Liposomal Lidocaine and Oral Sucrose for Treatment of Pain in Newborns Undergoing Venipuncture	pain	Sucrose (NPC130683)	NP level
NCT03745963	The Influence of Skin-to-skin Contact on Cortical Activity During Painful Procedures on Preterm Infants in the NICU	pain	Sucrose (NPC130683)	NP level
NCT00218946	Nasogastric Tube in Premature Babies - Pain and Treatment	premature birth	Sucrose (NPC130683)	NP level
NCT03082001	Sucrose to Reduce Pain During Initiation of Venipuncture in Extremely Low Birth Weight Babies	pain	Sucrose (NPC130683)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2,DRD1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2,DRD1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2,DRD1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	NCT01201954,NCT00482560,NCT02990364,NCT02174705,NCT01190995,NCT03745963,NCT03082001,NCT01561547,NCT00519207,NCT03272594,NCT00949104,NCT01503060
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD1
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	DRD1
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Congestive heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10	NCT00787059
Preterm newborn, unspecified Disease Category: 19.Certain conditions originating in the perinatal period Disease ICD-11 Code: KA21.4Z	NCT00218946
Orthostatic hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA21	NCT04855266
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	NCT02086864
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	NCT03718507
Retinopathy of prematurity Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71.3	NCT01238471
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DRD1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DRD1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Adesmia Boronioides

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

14 All known Ingredients in Total

11 Ingredients with Acceptable Bioavailablity

9 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of stomach

Adenocarcinoma of pancreas

Germ cell tumour of testis

Pain, unspecified

Parkinsonism

Cardiovascular disease

Tic disorder

Bleeding disorder

Psychotic disorder

Myocardial infarction

Type 2 diabetes mellitus

Ischaemic/haemorrhagic stroke

Thrombocytopenia

Coagulation defect

Schizophrenia

Multiple sclerosis

Nutritional deficiency

Allergic/hypersensitivity disorder

Cocaine use disorder

Coronary thrombosis

Thrombosis

Cerebral ischaemic stroke

Angina pectoris

Asthma

Pulmonary hypertension

Dementia

Abortion

Congestive heart failure

Preterm newborn, unspecified

Orthostatic hypotension

Attention deficit hyperactivity disorder

Acute respiratory distress syndrome

Retinopathy of prematurity

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Mesothelioma of pleura

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities