CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Salvia Castanea

Example Image

PLANiTS DNA barcode

TGTCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACGCTGCCGGGTGCGCGGCGCGGGGGTAACTCCCGTCTCGTACTCGGTTTCCCGCCGGCGCGCGTCCTTGGGCATGCGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATCGAAGCGTCCACCCCCCGCGCCCCGTTCGCGGTGCGTGCGGGGGGATCGGATGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCTCTCCCCGCGCATAGCGCGGTTTGCGGGGGCGGAAATTGGCCTCCCGTGCACCCCGGCGCGCGGCTGGCCCAAATGCGATCCCTCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACAACTCACTTCCGTGTCGTGCTTCTGCGTCGTCGGTATGGGCATCCGTAAACGACCCAACGGTGTCGGCGTCGCACGACGCCCCACCTTC

Taxonomic Information

Plant ID: NPO16750
Plant Latin Name: Salvia Castanea
Taxonomy Genus: Salvia
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 476450
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC988

Ingredient ID: NPC93241

Ingredient ID: NPC85771

Ingredient ID: NPC50315

Ingredient ID: NPC301691

Ingredient ID: NPC290249

Ingredient ID: NPC260000

Ingredient ID: NPC238861

Ingredient ID: NPC230479

Ingredient ID: NPC209560

Ingredient ID: NPC202431

Ingredient ID: NPC163649

Ingredient ID: NPC156751

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC126029

Ingredient ID: NPC125449

Ingredient ID: NPC121522

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2C9	Cytochrome P450 2C9	P11712	CHEMBL3397
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	ALPL	Alkaline phosphatase, tissue-nonspecific isozyme	P05186	CHEMBL5979
Therapeutic Target	Enzyme	PFKFB3	6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3	Q16875	CHEMBL2331053
Therapeutic Target	Hydrolase	CES2	Carboxylesterase 2	O00748	CHEMBL3180
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251
Therapeutic Target	Unclassified protein	ELAVL1	ELAV-like protein 1	Q15717	CHEMBL1250379

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	4

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01856868	Use of (-)-Epicatechin in the Treatment of Becker Muscular Dystrophy (Pilot Study)	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT00010686	Dietary Phytoestrogens and Bone Metabolism	osteoporosis	Formononetin (NPC209560)	NP level
NCT03236662	(-)- Epicatechin Becker Muscular Dystrophy	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT01880866	(-)-Epicatechin and Pulmonary Arterial Hypertension	pulmonary arterial hypertension	(-)-Epicatechin (NPC126029)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CYP2C9,CA14,CES2,CA2,CES1,ACHE,SNCA,PFKFB3
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA2,PFKFB3,NFKB1,CA14
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA14,ALPL,CA2,HSD17B10
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA14,ACHE,SNCA,CA2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA2,CYP2C9,CA14,ACHE
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	NFKB1,CYP2C9,ACHE,HSD17B10
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CYP2C9,CA14,ACHE,SNCA
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA14,CYP2C9,CA2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE,ELAVL1,HSD17B10
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	PFKFB3,ACHE,NFKB1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA2,ACHE,SNCA
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA2,CYP2C9,ALPL
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA,ACHE
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1,CA2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA14,CA2
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE,CA2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA,ACHE
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT01856868,NCT03236662
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALPL,CA2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP2C9,ACHE
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2,CYP2C9
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CYP2C9,ACHE
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	ALPL
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Genetic prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E02	ALPL
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2
Parasitic infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D0Y-1G2Z	ALPL
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01880866
Osteoporosis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83.1	NCT00010686
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	ALPL
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	CYP2C9
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	ALPL
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	ALPL
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	PFKFB3
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	ALPL
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	PFKFB3
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CYP2C9
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SNCA
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	ALPL
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	PFKFB3
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA2
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SNCA

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Salvia Castanea

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

18 All known Ingredients in Total

16 Ingredients with Acceptable Bioavailablity

14 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Solid tumour/cancer

Carcinosarcoma of uterus

Pheochromocytoma

Cytomegaloviral disease

Malignant neoplasms of thymus

Germ cell tumour of testis

Bacterial infection

Diffuse large B-cell lymphomas

West Nile virus infection

Superficial ovarian endometriosis

Malignant neoplasms of corpus uteri, unspecified

Parkinsonism

Rheumatoid arthritis

Breast cancer

Glaucoma

Alzheimer disease

Becker muscular dystrophy

Serous cystadenoma,borderline malignancy of ovary

Other specified malignant neoplasms of kidney, except renal pelvis

Urothelial carcinoma of bladder

Adenocarcinoma of bronchus or lung

Autonomic nervous system disorder

Lupus erythematosus

Atopic eczema

Colon cancer

Pain, unspecified

Genetic prion disease

Dementia

Insomnia

Heart failure

Duodenal ulcer

Inborn metabolism deficiency

Pediculosis

Parasitic worm infestation

Synthesis disorder

Choreiform disorder

Low bone mass disorder

Peroxisomal disease

Essential hypertension

Myasthenia gravis

Multiple sclerosis

Irritable bowel syndrome

Mild neurocognitive disorder

Psoriasis

Acute myeloid leukaemia

Fungal infection

Muscular dystrophy

Acute/subacute hepatic failure

Type 2 diabetes mellitus

Diabetes mellitus, type unspecified

Oesophageal/gastroduodenal disorder

Unspecific substance harmful effect

Seborrhoeic dermatitis

Parasitic infection

Chronic arterial occlusive disease

Indeterminate colitis

Substance abuse

Hyper-lipoproteinaemia

Skin and skin-structure infection

Pulmonary hypertension

Osteoporosis