CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Aconitum Heterophyllum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CGGAAACAAAGGTTTTCCGGGAAGGGGGAACCCTGCGGGAAAGGATTTCTTTGTTCGGAAACCCTGCCCCAAGCAGAGGCGAACCCCGCGAAACAAAGTGAAAACCAAACCCCGGACGGGCCCGAAAAAAGGGGGGGGCATGCCCCCCCGATTCGGTTGCCCGTTGGGACCCCCGACCTTTTTTTTTCAACCCGCCATTGATATGCGGGGGGGGAGGGGGTGGGTTCGTTTGTGTTCTGGGCAAAAACCAAAAACCGGCGCGACAGGCGCCAAAGGAAATCTTAGCGGAAAAGAGGGGTCCCCCGTTTGCGGAGGCAACCTTCAAAATCCGAAACTCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCGGAATCCCGTGAACCATCGAGTCTATGAAAGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCACCCCGTCAAACACGTTGATGGGGAGCGGAGATTGGCCCCCCGGACCCTTGCGGGCACGGTCGGCACAAATGTTGTCCCCGGCGGCGAGCCTCGCGGTCAGGGGTGTTTGTATTTTTCTTCCTCCAAAGACATCAAGACGCGTCGTCCTCGCTGCATGTTAGACACATCGACCCCACGGACCCGCTTCGCGTGGCATACACCAGGCGACCTCAGGTCAGG

Click for details-----ITS1

Click for details-----ITS2

ACAGCGTCGCACCCCGTCAAACACGTTGATGGGGAGCGGAGATTGGCCCCCCGGACCCTTGCGGGCACGGTCGGCACAAATGTTGTCCCCGGCGGCGAGCCTCGCGGTCAGGGGTGTTTGTATTTTTCTTCCTCCAAAGACATCAAGACGCGTCGTCCTCGCTGCATGTTAGACACATCGACCCCACGGACCCGCTTCGCGTGGCATACACCAGGCGACCTCAGGTCAGG

Taxonomic Information

Plant ID: NPO14508
Plant Latin Name: Aconitum Heterophyllum
Taxonomy Genus: Aconitum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 279769
Plant-of-the-World-Online: 707427-1

Used in Medicines

Country/Region:

China; India

Traditional Medicine System:

Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Medicinal Functions:

Analgesic; Antiinflammatory; Antiperiodic; Aphrodisiac; Astringent; Cholagogue; Febrifuge; Tonic

Geographical Distribution

India; Nepal; China; Bangladesh

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

45 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC96872

Ingredient ID: NPC93790

Ingredient ID: NPC93446

Ingredient ID: NPC8704

Ingredient ID: NPC86675

Ingredient ID: NPC82330

Ingredient ID: NPC76765

Ingredient ID: NPC76668

Ingredient ID: NPC73738

Ingredient ID: NPC69662

Ingredient ID: NPC68011

Ingredient ID: NPC53252

Ingredient ID: NPC51545

Ingredient ID: NPC43304

Ingredient ID: NPC41844

Ingredient ID: NPC41797

Ingredient ID: NPC38591

Ingredient ID: NPC326225

Ingredient ID: NPC301958

Ingredient ID: NPC29883

Ingredient ID: NPC298734

Ingredient ID: NPC296833

Ingredient ID: NPC287884

Ingredient ID: NPC287383

Ingredient ID: NPC284005

Ingredient ID: NPC251139

Ingredient ID: NPC247553

Ingredient ID: NPC239568

Ingredient ID: NPC232903

Ingredient ID: NPC232135

Ingredient ID: NPC231149

Ingredient ID: NPC216729

Ingredient ID: NPC213632

Ingredient ID: NPC203666

Ingredient ID: NPC19610

Ingredient ID: NPC192665

Ingredient ID: NPC187998

Ingredient ID: NPC179297

Ingredient ID: NPC174086

Ingredient ID: NPC154153

Ingredient ID: NPC125283

Ingredient ID: NPC116774

Ingredient ID: NPC111275

Ingredient ID: NPC102518

Ingredient ID: NPC101786

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA9,CA12,CA9
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CYP3A4,CA9,CA12
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,DRD1,CA9
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP3A4,DRD1,CA9
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CYP3A4,CA9
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA12,CA9
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA9
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,CA9
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA9
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DRD1,CA9
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP3A4,CA9
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CA9
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CA9
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CYP3A4
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,DRD1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CYP3A4
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	DRD1
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD1
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD1
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD1
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA9
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA9
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CA9
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Aconitum Heterophyllum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

45 All known Ingredients in Total

12 Ingredients with Acceptable Bioavailablity

17 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Hepatocellular carcinoma of liver

Solid tumour/cancer

Mesothelioma of pleura

Malignant neoplasms of thymus

Malignant neoplasms of adrenal gland

Breast cancer

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Adenocarcinoma of bronchus or lung

Invasive carcinoma of breast

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

Atopic eczema

Mature T-cell lymphoma

Dementia

Tic disorder

Anxiety

Seborrhoeic dermatitis

Schizophrenia

Abortion

Cocaine use disorder

Renal cell carcinoma

Psychotic disorder

Bacterial infection

Pulmonary hypertension

Parkinsonism

Allergic/hypersensitivity disorder

Carcinosarcoma of uterus

Osteoarthritis, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms ofcolon

Chronic rhinosinusitis

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities