CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Psammosilene Tunicoides

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGGGNCGCGGAANGATCATTGTCGAACCTGCCCAGCAGAACGACCCGCGAACTTTTTTATCTATCTTGGGCGTCGCGGCGTTGCTCGGTACCTTGTGTGCCACCTTGTCCTTCGCCCAAGCTGGGCACCGCCCACTTGTGGGCTGGTTGCTTGGCATTTAAACGAACCCCGGCGCGAAAAGCGTCAAGGAACATAAACTCAATGTGCGCGCCCTCCTCTTGCCCGGTTAGCCGGTGCATGGGTGTGGTGCCATGTCTTAACAATAAACGGCTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCTCCCCCACACCCACCTCGAGTGGAGGGGAAGGAGGATGGCTTCCCGTGCCTCACCGGGCGCGGGTGGCCTAAATTCGAAGCCCACGGCACTTAGCTGCCGCGGCGTTAGGTGGTGAACATGGCCTTCTCGGCCAAGCGAACAACCCGTCGGGAAGCGCCCTGCCAATGTGAGCTTGTAGGACCCTTTGAAGTTTGCATCACTGCAACTCAAACCGTTGCGACCCCAGNTCAGGCGGGTACC

Click for details-----ITS1

AAAGGCACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACAGTGTTTATCTATCTTGGGCGTCGCGGCGTTGCTCGGTACCTTGTGTGCCACCTCGTCCCTCGCCCAAGCTGGGCACCGCCCACTTGTGGGCTGGTTGCTTGGCACTTAAACGAACCCCGGCGCGAAAAGCGTCAAGGAACATAAACTCAATGTGCGCGCCCTCCTCTTGCCCGGTTAGCCGGTGCATGGGTGTGGTGCCATGTCTTAACAATAAA

Click for details-----ITS2

ATCGCGTCTCCCCAACACCCACCTCCAGTGGAGGGAAAGAAGGATGGCTTCCCGTGCCTCACCGGGCGCGGTTGGCCTAAATTCGGAGCCCACGGCACTAAGCTGCCGCGGCGTTAGGTGGTGAACATGGCCTTCTCGGCCAAGCGAACAACCCGTCGCGCAGCGCCCTGCCAATGTGAGCTTGTAGGACCCTTTGAAGTTTGCATCACTGCAACTCAAACCGTTGCGACCCCAGGTCAGGCGGGATNCCCGCT

Taxonomic Information

Plant ID: NPO10271
Plant Latin Name: Psammosilene Tunicoides
Taxonomy Genus: Psammosilene
Taxonomy Family: Caryophyllaceae

Plant External Links:

NCBI TaxonomyDB: 39860
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC84182

Ingredient ID: NPC72722

Ingredient ID: NPC69843

Ingredient ID: NPC60651

Ingredient ID: NPC323374

Ingredient ID: NPC321054

Ingredient ID: NPC320816

Ingredient ID: NPC31915

Ingredient ID: NPC317566

Ingredient ID: NPC3128

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC283823

Ingredient ID: NPC265328

Ingredient ID: NPC259196

Ingredient ID: NPC243728

Ingredient ID: NPC236709

Ingredient ID: NPC235251

Ingredient ID: NPC230301

Ingredient ID: NPC222047

Ingredient ID: NPC214532

Ingredient ID: NPC212940

Ingredient ID: NPC205076

Ingredient ID: NPC196007

Ingredient ID: NPC194175

Ingredient ID: NPC19047

Ingredient ID: NPC181390

Ingredient ID: NPC175359

Ingredient ID: NPC173748

Ingredient ID: NPC165967

Ingredient ID: NPC163866

Ingredient ID: NPC163270

Ingredient ID: NPC151490

Ingredient ID: NPC131192

Ingredient ID: NPC129417

Ingredient ID: NPC117805

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04649203	Cytoflavin in the Treatment of Patients With Diabetic Polyneuropathy	diabetic neuropathy	Succinic Acid (NPC236709)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA7,CA9,CA12,F2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA7,CA9,LMNA,F2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA7,CA9,CA12,LMNA
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA9,CA12,CA9
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA7,CA9,CA12,F2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,CA9,LMNA
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,F2,CA9
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CA9,LMNA
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA7,CA9,CA12
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA12,CA9
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA9,CA12
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA7,CA9
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA9
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA9,LMNA
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2,CA9
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9,F2
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA7,CA12
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2,CA9
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,F2
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT04649203
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CA9
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Psammosilene Tunicoides

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

36 All known Ingredients in Total

20 Ingredients with Acceptable Bioavailablity

17 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Adenocarcinoma of bronchus or lung

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Solid tumour/cancer

Breast cancer

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Invasive carcinoma of breast

Germ cell tumour of testis

Renal cell carcinoma

Nutritional deficiency

Thrombocytopenia

Angina pectoris

Mature T-cell lymphoma

Seborrhoeic dermatitis

Bleeding disorder

Type 2 diabetes mellitus

Ischaemic/haemorrhagic stroke

Coagulation defect

Coronary thrombosis

Thrombosis

Asthma

Multiple sclerosis

Cerebral ischaemic stroke

Bacterial infection

Cardiovascular disease

Myocardial infarction

Diabetic polyneuropathy

Osteoarthritis, unspecified

Hepatoblastoma

Adenocarcinoma of stomach

Atrial fibrillation

Tetralogy of Fallot

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Chronic rhinosinusitis

Chikungunya virus disease

Malignant neoplasms of thymus

Renal cell carcinoma, chromophobe type

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities